Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633326_at:

>probe:Drosophila_2:1633326_at:338:437; Interrogation_Position=2539; Antisense; GAGGACACGCCCATCGATATTATTA
>probe:Drosophila_2:1633326_at:227:5; Interrogation_Position=2575; Antisense; ATTGTGGCAGACAACGGCACCGCTG
>probe:Drosophila_2:1633326_at:676:289; Interrogation_Position=2600; Antisense; CGGAGCTCAATCAGGCGTCGGTGAA
>probe:Drosophila_2:1633326_at:477:599; Interrogation_Position=2642; Antisense; TGTTCAATGCCACCGACTGGGAGAT
>probe:Drosophila_2:1633326_at:526:587; Interrogation_Position=2666; Antisense; TGGAGCTGGATCAGGCAGCCACCAA
>probe:Drosophila_2:1633326_at:13:355; Interrogation_Position=2699; Antisense; GCACGACCTCGAAACAAGCTCTGGA
>probe:Drosophila_2:1633326_at:186:485; Interrogation_Position=2774; Antisense; GTAGTGAGCAGCCATCTACCATGGA
>probe:Drosophila_2:1633326_at:706:247; Interrogation_Position=2814; Antisense; AATTGAGCTGCACCCGGAGGATGAC
>probe:Drosophila_2:1633326_at:723:399; Interrogation_Position=2836; Antisense; GACAGTGCCATCGAGTACGTCGACA
>probe:Drosophila_2:1633326_at:247:671; Interrogation_Position=2851; Antisense; TACGTCGACATGGACCTGGAGCAGC
>probe:Drosophila_2:1633326_at:358:419; Interrogation_Position=2869; Antisense; GAGCAGCCCGTCGAGATTGAGAGCA
>probe:Drosophila_2:1633326_at:651:425; Interrogation_Position=2887; Antisense; GAGAGCACCAGCAACATATCGCCAG
>probe:Drosophila_2:1633326_at:194:143; Interrogation_Position=2997; Antisense; ACTGGAGCATCCACTGAGCGCAGGA
>probe:Drosophila_2:1633326_at:340:113; Interrogation_Position=3043; Antisense; AGCACGGGAGCAGCTGTCCAATCAG

Paste this into a BLAST search page for me
GAGGACACGCCCATCGATATTATTAATTGTGGCAGACAACGGCACCGCTGCGGAGCTCAATCAGGCGTCGGTGAATGTTCAATGCCACCGACTGGGAGATTGGAGCTGGATCAGGCAGCCACCAAGCACGACCTCGAAACAAGCTCTGGAGTAGTGAGCAGCCATCTACCATGGAAATTGAGCTGCACCCGGAGGATGACGACAGTGCCATCGAGTACGTCGACATACGTCGACATGGACCTGGAGCAGCGAGCAGCCCGTCGAGATTGAGAGCAGAGAGCACCAGCAACATATCGCCAGACTGGAGCATCCACTGAGCGCAGGAAGCACGGGAGCAGCTGTCCAATCAG

Full Affymetrix probeset data:

Annotations for 1633326_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime