FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633327_at:

>probe:Drosophila_2:1633327_at:46:33; Interrogation_Position=1208; Antisense; ATAATCCCGGTACCAGTGCACTGCA
>probe:Drosophila_2:1633327_at:729:143; Interrogation_Position=1227; Antisense; ACTGCAACGGCGTCCACTGGTGCAT
>probe:Drosophila_2:1633327_at:72:397; Interrogation_Position=1276; Antisense; GACAATCCGGTATTATGACTCAAAG
>probe:Drosophila_2:1633327_at:690:391; Interrogation_Position=1302; Antisense; GAAAGCCAAACCGACCAGTGCTGGA
>probe:Drosophila_2:1633327_at:722:323; Interrogation_Position=1347; Antisense; GCGAAGAGTCAATATTCAAGCCCAA
>probe:Drosophila_2:1633327_at:665:347; Interrogation_Position=1375; Antisense; GCAGTTTGATACCAGCGATTTTGTT
>probe:Drosophila_2:1633327_at:407:27; Interrogation_Position=1418; Antisense; ATACCACGACAGTTAGATGGCAGCG
>probe:Drosophila_2:1633327_at:57:441; Interrogation_Position=1433; Antisense; GATGGCAGCGATTGCGGTATCTTCA
>probe:Drosophila_2:1633327_at:62:517; Interrogation_Position=1483; Antisense; GTGTGATGTGCCAATTACCTTTACC
>probe:Drosophila_2:1633327_at:522:673; Interrogation_Position=1498; Antisense; TACCTTTACCCAGTCGGAAATGTTG
>probe:Drosophila_2:1633327_at:691:489; Interrogation_Position=1522; Antisense; GTACTTCCGCAAGAAGATGGCTCTA
>probe:Drosophila_2:1633327_at:127:441; Interrogation_Position=1537; Antisense; GATGGCTCTAGAAATCGTCGACGGA
>probe:Drosophila_2:1633327_at:451:365; Interrogation_Position=1576; Antisense; GAATCACACAGCTACGCAAGAATGT
>probe:Drosophila_2:1633327_at:322:697; Interrogation_Position=1677; Antisense; TTTAATTGAATTGAGCTGGCCGAGA

Paste this into a BLAST search page for me
ATAATCCCGGTACCAGTGCACTGCAACTGCAACGGCGTCCACTGGTGCATGACAATCCGGTATTATGACTCAAAGGAAAGCCAAACCGACCAGTGCTGGAGCGAAGAGTCAATATTCAAGCCCAAGCAGTTTGATACCAGCGATTTTGTTATACCACGACAGTTAGATGGCAGCGGATGGCAGCGATTGCGGTATCTTCAGTGTGATGTGCCAATTACCTTTACCTACCTTTACCCAGTCGGAAATGTTGGTACTTCCGCAAGAAGATGGCTCTAGATGGCTCTAGAAATCGTCGACGGAGAATCACACAGCTACGCAAGAATGTTTTAATTGAATTGAGCTGGCCGAGA

Full Affymetrix probeset data:

Annotations for 1633327_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720