FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633328_at:

>probe:Drosophila_2:1633328_at:223:517; Interrogation_Position=274; Antisense; GTGTCCCAAGTGCAACCACGACAAG
>probe:Drosophila_2:1633328_at:242:409; Interrogation_Position=332; Antisense; GACGAAGGCCAGACGGTGTTCTTTA
>probe:Drosophila_2:1633328_at:69:513; Interrogation_Position=347; Antisense; GTGTTCTTTACCTGCCTTAAGTGCA
>probe:Drosophila_2:1633328_at:478:361; Interrogation_Position=404; Antisense; GCAATGTCCGTGTAAATAGTCCTAG
>probe:Drosophila_2:1633328_at:250:185; Interrogation_Position=436; Antisense; AAAATAATCATGCTCGACGGCCTGA
>probe:Drosophila_2:1633328_at:368:427; Interrogation_Position=486; Antisense; TACCTAACCGGTGTCAAACTTGAAG
>probe:Drosophila_2:1633328_at:355:485; Interrogation_Position=551; Antisense; GTAGACCACCAGATTCGAGACCAGA
>probe:Drosophila_2:1633328_at:428:93; Interrogation_Position=573; Antisense; AGATTGATTTCCACCGCATGTGTGC
>probe:Drosophila_2:1633328_at:9:187; Interrogation_Position=606; Antisense; AACAAGTTGTCCCAGTGAATGCCCA
>probe:Drosophila_2:1633328_at:526:233; Interrogation_Position=688; Antisense; AATGCCTACCGTATCTTGCTGTAAT
>probe:Drosophila_2:1633328_at:67:143; Interrogation_Position=737; Antisense; ACTGATTCAGACGTGGGCTGCCCAG
>probe:Drosophila_2:1633328_at:349:573; Interrogation_Position=752; Antisense; GGCTGCCCAGAGTGCGAATGATGAT
>probe:Drosophila_2:1633328_at:25:607; Interrogation_Position=773; Antisense; TGATGGCTAATTGCTCGATGTCGGT
>probe:Drosophila_2:1633328_at:614:441; Interrogation_Position=789; Antisense; GATGTCGGTGGTTCCCGCAAACAGG

Paste this into a BLAST search page for me
GTGTCCCAAGTGCAACCACGACAAGGACGAAGGCCAGACGGTGTTCTTTAGTGTTCTTTACCTGCCTTAAGTGCAGCAATGTCCGTGTAAATAGTCCTAGAAAATAATCATGCTCGACGGCCTGATACCTAACCGGTGTCAAACTTGAAGGTAGACCACCAGATTCGAGACCAGAAGATTGATTTCCACCGCATGTGTGCAACAAGTTGTCCCAGTGAATGCCCAAATGCCTACCGTATCTTGCTGTAATACTGATTCAGACGTGGGCTGCCCAGGGCTGCCCAGAGTGCGAATGATGATTGATGGCTAATTGCTCGATGTCGGTGATGTCGGTGGTTCCCGCAAACAGG

Full Affymetrix probeset data:

Annotations for 1633328_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720