FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633329_at:

>probe:Drosophila_2:1633329_at:163:65; Interrogation_Position=1003; Antisense; ATGGTGCCTATGAATATCTTGTTAA
>probe:Drosophila_2:1633329_at:658:35; Interrogation_Position=1018; Antisense; ATCTTGTTAAACGAATCTGTGTGGC
>probe:Drosophila_2:1633329_at:68:641; Interrogation_Position=1033; Antisense; TCTGTGTGGCAAACGAATACTCAAG
>probe:Drosophila_2:1633329_at:116:489; Interrogation_Position=1059; Antisense; GTACGCCAAGTACTTCATACCAATT
>probe:Drosophila_2:1633329_at:39:413; Interrogation_Position=1087; Antisense; GACCGCGGATATAATTCTCAATCAT
>probe:Drosophila_2:1633329_at:577:237; Interrogation_Position=1106; Antisense; AATCATCTACATCAGGAGTTACAAG
>probe:Drosophila_2:1633329_at:68:371; Interrogation_Position=1131; Antisense; GAATGGCATTATGTTTTTTACACAA
>probe:Drosophila_2:1633329_at:595:545; Interrogation_Position=1174; Antisense; GGATGCTGGGATACATCGAAACCAT
>probe:Drosophila_2:1633329_at:441:391; Interrogation_Position=1191; Antisense; GAAACCATACACTCGAGCACATTTG
>probe:Drosophila_2:1633329_at:397:569; Interrogation_Position=1301; Antisense; GGCTTATAAGTAACCGACTACCAAT
>probe:Drosophila_2:1633329_at:312:403; Interrogation_Position=1316; Antisense; GACTACCAATTTTTCTATACAGCAA
>probe:Drosophila_2:1633329_at:159:239; Interrogation_Position=1402; Antisense; AATAGTGTTTGCAATCCGGATAATA
>probe:Drosophila_2:1633329_at:437:381; Interrogation_Position=958; Antisense; GAACGCGTTCTTTATTTTCATCCAA
>probe:Drosophila_2:1633329_at:256:479; Interrogation_Position=989; Antisense; GTTTCAAGGAGTTCATGGTGCCTAT

Paste this into a BLAST search page for me
ATGGTGCCTATGAATATCTTGTTAAATCTTGTTAAACGAATCTGTGTGGCTCTGTGTGGCAAACGAATACTCAAGGTACGCCAAGTACTTCATACCAATTGACCGCGGATATAATTCTCAATCATAATCATCTACATCAGGAGTTACAAGGAATGGCATTATGTTTTTTACACAAGGATGCTGGGATACATCGAAACCATGAAACCATACACTCGAGCACATTTGGGCTTATAAGTAACCGACTACCAATGACTACCAATTTTTCTATACAGCAAAATAGTGTTTGCAATCCGGATAATAGAACGCGTTCTTTATTTTCATCCAAGTTTCAAGGAGTTCATGGTGCCTAT

Full Affymetrix probeset data:

Annotations for 1633329_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720