FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633331_at:

>probe:Drosophila_2:1633331_at:570:9; Interrogation_Position=7981; Antisense; ATTCGTCTGTGCAACCAATGGCTTC
>probe:Drosophila_2:1633331_at:222:597; Interrogation_Position=7988; Antisense; TGTGCAACCAATGGCTTCCTTTGTA
>probe:Drosophila_2:1633331_at:179:721; Interrogation_Position=8003; Antisense; TTCCTTTGTAGCCTCTTATGTTTTG
>probe:Drosophila_2:1633331_at:659:529; Interrogation_Position=8037; Antisense; GGGATCAGATGTCCTAATTTTTCAT
>probe:Drosophila_2:1633331_at:528:391; Interrogation_Position=8091; Antisense; GAAAGAAATCCATTCCTAAGGCGTA
>probe:Drosophila_2:1633331_at:408:9; Interrogation_Position=8102; Antisense; ATTCCTAAGGCGTATCCATTCCTGT
>probe:Drosophila_2:1633331_at:310:273; Interrogation_Position=8118; Antisense; CATTCCTGTCGCTTCGGGAAAGATT
>probe:Drosophila_2:1633331_at:280:559; Interrogation_Position=8163; Antisense; GGAACAAAAACGGACGACTTGTCAT
>probe:Drosophila_2:1633331_at:522:599; Interrogation_Position=8239; Antisense; TGCACGATTGTATAATGCGTATAGC
>probe:Drosophila_2:1633331_at:679:13; Interrogation_Position=8278; Antisense; ATTACCACATCCTCGATTGTTGTTG
>probe:Drosophila_2:1633331_at:411:425; Interrogation_Position=8331; Antisense; GAGACCACAGATCAAACTCCTTTCC
>probe:Drosophila_2:1633331_at:97:145; Interrogation_Position=8346; Antisense; ACTCCTTTCCCAAAAACTGCATTAG
>probe:Drosophila_2:1633331_at:29:273; Interrogation_Position=8429; Antisense; TTTGTACTCTAACCTAAATGGAACA
>probe:Drosophila_2:1633331_at:251:399; Interrogation_Position=8497; Antisense; GACACAGAACTCATTTCGTATGCTT

Paste this into a BLAST search page for me
ATTCGTCTGTGCAACCAATGGCTTCTGTGCAACCAATGGCTTCCTTTGTATTCCTTTGTAGCCTCTTATGTTTTGGGGATCAGATGTCCTAATTTTTCATGAAAGAAATCCATTCCTAAGGCGTAATTCCTAAGGCGTATCCATTCCTGTCATTCCTGTCGCTTCGGGAAAGATTGGAACAAAAACGGACGACTTGTCATTGCACGATTGTATAATGCGTATAGCATTACCACATCCTCGATTGTTGTTGGAGACCACAGATCAAACTCCTTTCCACTCCTTTCCCAAAAACTGCATTAGTTTGTACTCTAACCTAAATGGAACAGACACAGAACTCATTTCGTATGCTT

Full Affymetrix probeset data:

Annotations for 1633331_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720