FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633334_at:

>probe:Drosophila_2:1633334_at:497:397; Interrogation_Position=3581; Antisense; GACAAGCTGTCCCAGTTGAAAGATG
>probe:Drosophila_2:1633334_at:472:441; Interrogation_Position=3602; Antisense; GATGAACACAAAACGATTTCCCGCC
>probe:Drosophila_2:1633334_at:676:13; Interrogation_Position=3629; Antisense; ATTAACCAGCGCCATTTGCTTCTCT
>probe:Drosophila_2:1633334_at:533:47; Interrogation_Position=3658; Antisense; ATCCTCGACATTCTTGCCATTAATT
>probe:Drosophila_2:1633334_at:118:269; Interrogation_Position=3689; Antisense; CATACTATTTTTGCTGTTTTCCCAA
>probe:Drosophila_2:1633334_at:514:253; Interrogation_Position=3711; Antisense; CAAAACCAATTTTAGCCCATGAGCT
>probe:Drosophila_2:1633334_at:73:481; Interrogation_Position=3760; Antisense; GTTTGCCATTTTACTTTGCATGATT
>probe:Drosophila_2:1633334_at:4:271; Interrogation_Position=3778; Antisense; CATGATTGTTCACTGTTTTCTACCA
>probe:Drosophila_2:1633334_at:119:97; Interrogation_Position=3836; Antisense; AGATATACTAAAATGCCTGCGCAAA
>probe:Drosophila_2:1633334_at:132:703; Interrogation_Position=3894; Antisense; TTTTGCTTATACTTTCTCTGCTTTA
>probe:Drosophila_2:1633334_at:588:697; Interrogation_Position=4022; Antisense; TTTAAATTCACTTACGGCCAGTCGA
>probe:Drosophila_2:1633334_at:450:287; Interrogation_Position=4036; Antisense; CGGCCAGTCGAAATTTTTGCCATTA
>probe:Drosophila_2:1633334_at:361:697; Interrogation_Position=4081; Antisense; TTATAACTATTTCTCCCACACAGTC
>probe:Drosophila_2:1633334_at:209:651; Interrogation_Position=4129; Antisense; TAATATCGAACATGTTTTACCCCAA

Paste this into a BLAST search page for me
GACAAGCTGTCCCAGTTGAAAGATGGATGAACACAAAACGATTTCCCGCCATTAACCAGCGCCATTTGCTTCTCTATCCTCGACATTCTTGCCATTAATTCATACTATTTTTGCTGTTTTCCCAACAAAACCAATTTTAGCCCATGAGCTGTTTGCCATTTTACTTTGCATGATTCATGATTGTTCACTGTTTTCTACCAAGATATACTAAAATGCCTGCGCAAATTTTGCTTATACTTTCTCTGCTTTATTTAAATTCACTTACGGCCAGTCGACGGCCAGTCGAAATTTTTGCCATTATTATAACTATTTCTCCCACACAGTCTAATATCGAACATGTTTTACCCCAA

Full Affymetrix probeset data:

Annotations for 1633334_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720