FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633335_at:

>probe:Drosophila_2:1633335_at:110:225; Interrogation_Position=5055; Antisense; AAGGAGTTCTTTCCGATTGCCACGA
>probe:Drosophila_2:1633335_at:573:7; Interrogation_Position=5070; Antisense; ATTGCCACGAGCCTCGAGGGCACAC
>probe:Drosophila_2:1633335_at:661:689; Interrogation_Position=5101; Antisense; TTCCACCAAAACCTAGTCTAAGCGC
>probe:Drosophila_2:1633335_at:493:205; Interrogation_Position=5120; Antisense; AAGCGCTAACTTCTATAACAATCCA
>probe:Drosophila_2:1633335_at:212:669; Interrogation_Position=5153; Antisense; TACGATGTTTCTTTACCCAAGTACA
>probe:Drosophila_2:1633335_at:11:241; Interrogation_Position=5185; Antisense; AATAATTTAAATTGCCTGGCGATGT
>probe:Drosophila_2:1633335_at:220:711; Interrogation_Position=5245; Antisense; TTCAAAGTTGCGAGCACTGCTTGAG
>probe:Drosophila_2:1633335_at:260:139; Interrogation_Position=5329; Antisense; ACGTAGGCGCAGTTTATGTATTCTA
>probe:Drosophila_2:1633335_at:176:201; Interrogation_Position=5370; Antisense; AACCGCTGATTTAGATTATTCGCCA
>probe:Drosophila_2:1633335_at:110:703; Interrogation_Position=5385; Antisense; TTATTCGCCACTCATTTAACAAGGT
>probe:Drosophila_2:1633335_at:134:165; Interrogation_Position=5428; Antisense; AAATACGCTCTCATTTACACACAAC
>probe:Drosophila_2:1633335_at:409:17; Interrogation_Position=5440; Antisense; ATTTACACACAACAGGCACGCGCAT
>probe:Drosophila_2:1633335_at:133:269; Interrogation_Position=5452; Antisense; CAGGCACGCGCATATGGATAGGAAT
>probe:Drosophila_2:1633335_at:124:565; Interrogation_Position=5472; Antisense; GGAATGCAGGACACACAAACCAAGC

Paste this into a BLAST search page for me
AAGGAGTTCTTTCCGATTGCCACGAATTGCCACGAGCCTCGAGGGCACACTTCCACCAAAACCTAGTCTAAGCGCAAGCGCTAACTTCTATAACAATCCATACGATGTTTCTTTACCCAAGTACAAATAATTTAAATTGCCTGGCGATGTTTCAAAGTTGCGAGCACTGCTTGAGACGTAGGCGCAGTTTATGTATTCTAAACCGCTGATTTAGATTATTCGCCATTATTCGCCACTCATTTAACAAGGTAAATACGCTCTCATTTACACACAACATTTACACACAACAGGCACGCGCATCAGGCACGCGCATATGGATAGGAATGGAATGCAGGACACACAAACCAAGC

Full Affymetrix probeset data:

Annotations for 1633335_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720