Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633336_at:

>probe:Drosophila_2:1633336_at:721:113; Interrogation_Position=4799; Antisense; AGCAGGGCCAGCAGATTGCGGCACT
>probe:Drosophila_2:1633336_at:529:589; Interrogation_Position=4823; Antisense; TGGATGCGGCCAACAGCCGGCTGCT
>probe:Drosophila_2:1633336_at:659:187; Interrogation_Position=4834; Antisense; AACAGCCGGCTGCTGAGTGCCCTGA
>probe:Drosophila_2:1633336_at:317:625; Interrogation_Position=4865; Antisense; TGCGCCAGCGGTACGAGACCCAGCA
>probe:Drosophila_2:1633336_at:272:173; Interrogation_Position=4917; Antisense; AAAGACCCAGAAGCCGCAGTGAGCG
>probe:Drosophila_2:1633336_at:719:459; Interrogation_Position=4988; Antisense; GATTAGGAGGTGACCGCGACCGAAC
>probe:Drosophila_2:1633336_at:272:131; Interrogation_Position=5018; Antisense; ACCGAAACCGATACCTAGCATACCT
>probe:Drosophila_2:1633336_at:694:673; Interrogation_Position=5033; Antisense; TAGCATACCTAGCATACTGACGGTG
>probe:Drosophila_2:1633336_at:345:271; Interrogation_Position=5045; Antisense; CATACTGACGGTGGCATCTTTGTTG
>probe:Drosophila_2:1633336_at:543:35; Interrogation_Position=5060; Antisense; ATCTTTGTTGCGCTGGACACCGTCG
>probe:Drosophila_2:1633336_at:590:453; Interrogation_Position=5087; Antisense; GTCCCGTCTTAGAGATACCTTTTTG
>probe:Drosophila_2:1633336_at:265:3; Interrogation_Position=5249; Antisense; ATTGTGAAAACGCTAAACGCAGCTG
>probe:Drosophila_2:1633336_at:588:165; Interrogation_Position=5275; Antisense; AAAGGCAGCAAGATAAACCCCAGAA
>probe:Drosophila_2:1633336_at:561:201; Interrogation_Position=5290; Antisense; AACCCCAGAAGATCGGAGCATGGAA

Paste this into a BLAST search page for me
AGCAGGGCCAGCAGATTGCGGCACTTGGATGCGGCCAACAGCCGGCTGCTAACAGCCGGCTGCTGAGTGCCCTGATGCGCCAGCGGTACGAGACCCAGCAAAAGACCCAGAAGCCGCAGTGAGCGGATTAGGAGGTGACCGCGACCGAACACCGAAACCGATACCTAGCATACCTTAGCATACCTAGCATACTGACGGTGCATACTGACGGTGGCATCTTTGTTGATCTTTGTTGCGCTGGACACCGTCGGTCCCGTCTTAGAGATACCTTTTTGATTGTGAAAACGCTAAACGCAGCTGAAAGGCAGCAAGATAAACCCCAGAAAACCCCAGAAGATCGGAGCATGGAA

Full Affymetrix probeset data:

Annotations for 1633336_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime