FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633337_at:

>probe:Drosophila_2:1633337_at:142:371; Interrogation_Position=2031; Antisense; GAATGGCAGCTGTCCGGGCAATAAT
>probe:Drosophila_2:1633337_at:380:197; Interrogation_Position=2080; Antisense; AACGGATCCATGCAGTTCGAGCGAA
>probe:Drosophila_2:1633337_at:652:425; Interrogation_Position=2122; Antisense; GAGAGCAGTGGCTTCTATCGTCGCC
>probe:Drosophila_2:1633337_at:404:503; Interrogation_Position=2141; Antisense; GTCGCCCGTCGAACGATTTCAATAT
>probe:Drosophila_2:1633337_at:728:263; Interrogation_Position=2178; Antisense; CATCCAAACCGATCAGCTGGTGGGT
>probe:Drosophila_2:1633337_at:468:79; Interrogation_Position=2222; Antisense; AGGTGTGGCCACGTCGTTACTCCAA
>probe:Drosophila_2:1633337_at:219:213; Interrogation_Position=2307; Antisense; AAGACGTATATCCACGGACTCGGGA
>probe:Drosophila_2:1633337_at:431:405; Interrogation_Position=2323; Antisense; GACTCGGGATACGATCGTCGCTGCT
>probe:Drosophila_2:1633337_at:43:51; Interrogation_Position=2343; Antisense; CTGCTCGTTTGGATCGGAAGGCTTC
>probe:Drosophila_2:1633337_at:274:371; Interrogation_Position=2359; Antisense; GAAGGCTTCGAAGGATCTCCACGAT
>probe:Drosophila_2:1633337_at:300:353; Interrogation_Position=2387; Antisense; GCACCGGTAGCTTCCTGAGCAACTA
>probe:Drosophila_2:1633337_at:547:607; Interrogation_Position=2402; Antisense; TGAGCAACTACAAGCACGGCGGCGG
>probe:Drosophila_2:1633337_at:38:377; Interrogation_Position=2456; Antisense; GAACCGGTAGCTTCCTCGACGGATC
>probe:Drosophila_2:1633337_at:224:559; Interrogation_Position=2590; Antisense; GGACAGACCATATCGCCCGTAAATT

Paste this into a BLAST search page for me
GAATGGCAGCTGTCCGGGCAATAATAACGGATCCATGCAGTTCGAGCGAAGAGAGCAGTGGCTTCTATCGTCGCCGTCGCCCGTCGAACGATTTCAATATCATCCAAACCGATCAGCTGGTGGGTAGGTGTGGCCACGTCGTTACTCCAAAAGACGTATATCCACGGACTCGGGAGACTCGGGATACGATCGTCGCTGCTCTGCTCGTTTGGATCGGAAGGCTTCGAAGGCTTCGAAGGATCTCCACGATGCACCGGTAGCTTCCTGAGCAACTATGAGCAACTACAAGCACGGCGGCGGGAACCGGTAGCTTCCTCGACGGATCGGACAGACCATATCGCCCGTAAATT

Full Affymetrix probeset data:

Annotations for 1633337_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720