FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633338_at:

>probe:Drosophila_2:1633338_at:406:17; Interrogation_Position=162; Antisense; ATTTGGTACGATGTGTACGCCGCCT
>probe:Drosophila_2:1633338_at:541:607; Interrogation_Position=227; Antisense; TGAGATTCCAGTGCGCCAGATATTT
>probe:Drosophila_2:1633338_at:549:321; Interrogation_Position=239; Antisense; GCGCCAGATATTTTATGCCGAGGAT
>probe:Drosophila_2:1633338_at:515:443; Interrogation_Position=261; Antisense; GATGTTGTCCGAGCAAAGCTGCATA
>probe:Drosophila_2:1633338_at:416:391; Interrogation_Position=303; Antisense; GAAACGATATCCCTGTTTGACCACA
>probe:Drosophila_2:1633338_at:61:351; Interrogation_Position=338; Antisense; GCAGTCACAGCAATTTGTCCAAATA
>probe:Drosophila_2:1633338_at:36:225; Interrogation_Position=401; Antisense; AAGGATCTACGAGACCGCACTGGAT
>probe:Drosophila_2:1633338_at:727:355; Interrogation_Position=417; Antisense; GCACTGGATCTTTTGGCGGAGCAGC
>probe:Drosophila_2:1633338_at:468:547; Interrogation_Position=458; Antisense; GGAGACTACCCCAGAGGAATGCCTG
>probe:Drosophila_2:1633338_at:360:541; Interrogation_Position=491; Antisense; GGATTCGGAATCCAAGTCCCAGCTG
>probe:Drosophila_2:1633338_at:614:119; Interrogation_Position=511; Antisense; AGCTGCTGAGCGACTTCAAGGAGGC
>probe:Drosophila_2:1633338_at:673:533; Interrogation_Position=539; Antisense; GGTGAGCCAGCAAATCACGTCGTCA
>probe:Drosophila_2:1633338_at:422:421; Interrogation_Position=636; Antisense; TAGGCGGAACATCTTTTATAAACTT
>probe:Drosophila_2:1633338_at:299:161; Interrogation_Position=99; Antisense; ACAATCTTCACCAGAGTTCAGGGCC

Paste this into a BLAST search page for me
ATTTGGTACGATGTGTACGCCGCCTTGAGATTCCAGTGCGCCAGATATTTGCGCCAGATATTTTATGCCGAGGATGATGTTGTCCGAGCAAAGCTGCATAGAAACGATATCCCTGTTTGACCACAGCAGTCACAGCAATTTGTCCAAATAAAGGATCTACGAGACCGCACTGGATGCACTGGATCTTTTGGCGGAGCAGCGGAGACTACCCCAGAGGAATGCCTGGGATTCGGAATCCAAGTCCCAGCTGAGCTGCTGAGCGACTTCAAGGAGGCGGTGAGCCAGCAAATCACGTCGTCATAGGCGGAACATCTTTTATAAACTTACAATCTTCACCAGAGTTCAGGGCC

Full Affymetrix probeset data:

Annotations for 1633338_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720