FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633340_at:

>probe:Drosophila_2:1633340_at:383:617; Interrogation_Position=104; Antisense; TGCACAGCCATCACAGGGGTCAACT
>probe:Drosophila_2:1633340_at:324:531; Interrogation_Position=120; Antisense; GGGTCAACTGCCACGGGACGGAGGT
>probe:Drosophila_2:1633340_at:101:67; Interrogation_Position=13; Antisense; ATGGACGCACCGCTAGAGATCACCT
>probe:Drosophila_2:1633340_at:370:587; Interrogation_Position=14; Antisense; TGGACGCACCGCTAGAGATCACCTC
>probe:Drosophila_2:1633340_at:101:355; Interrogation_Position=19; Antisense; GCACCGCTAGAGATCACCTCCTTGA
>probe:Drosophila_2:1633340_at:289:341; Interrogation_Position=24; Antisense; GCTAGAGATCACCTCCTTGACTGGG
>probe:Drosophila_2:1633340_at:216:677; Interrogation_Position=26; Antisense; TAGAGATCACCTCCTTGACTGGGCC
>probe:Drosophila_2:1633340_at:445:427; Interrogation_Position=28; Antisense; GAGATCACCTCCTTGACTGGGCCAC
>probe:Drosophila_2:1633340_at:182:131; Interrogation_Position=34; Antisense; ACCTCCTTGACTGGGCCACCTGTGG
>probe:Drosophila_2:1633340_at:682:309; Interrogation_Position=49; Antisense; CCACCTGTGGGCGTGGTCGACGACA
>probe:Drosophila_2:1633340_at:315:517; Interrogation_Position=55; Antisense; GTGGGCGTGGTCGACGACAGCAGCA
>probe:Drosophila_2:1633340_at:481:113; Interrogation_Position=91; Antisense; AGCAGCAAACACATGCACAGCCATC
>probe:Drosophila_2:1633340_at:588:357; Interrogation_Position=95; Antisense; GCAAACACATGCACAGCCATCACAG
>probe:Drosophila_2:1633340_at:43:181; Interrogation_Position=97; Antisense; AAACACATGCACAGCCATCACAGGG

Paste this into a BLAST search page for me
TGCACAGCCATCACAGGGGTCAACTGGGTCAACTGCCACGGGACGGAGGTATGGACGCACCGCTAGAGATCACCTTGGACGCACCGCTAGAGATCACCTCGCACCGCTAGAGATCACCTCCTTGAGCTAGAGATCACCTCCTTGACTGGGTAGAGATCACCTCCTTGACTGGGCCGAGATCACCTCCTTGACTGGGCCACACCTCCTTGACTGGGCCACCTGTGGCCACCTGTGGGCGTGGTCGACGACAGTGGGCGTGGTCGACGACAGCAGCAAGCAGCAAACACATGCACAGCCATCGCAAACACATGCACAGCCATCACAGAAACACATGCACAGCCATCACAGGG

Full Affymetrix probeset data:

Annotations for 1633340_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720