FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633343_at:

>probe:Drosophila_2:1633343_at:608:137; Interrogation_Position=442; Antisense; ACGATACGGTCTCGAAGGCCCGAAG
>probe:Drosophila_2:1633343_at:720:567; Interrogation_Position=512; Antisense; GGCACGCCGTGCATTCTAATAAAGA
>probe:Drosophila_2:1633343_at:40:69; Interrogation_Position=543; Antisense; AGGCATTGGGCTTCCAGGCGGTAAC
>probe:Drosophila_2:1633343_at:99:423; Interrogation_Position=562; Antisense; GGTAACCTACGATGACGCCCTAACG
>probe:Drosophila_2:1633343_at:93:283; Interrogation_Position=600; Antisense; CTCCGGATGAGCTATTCGACTATGT
>probe:Drosophila_2:1633343_at:447:515; Interrogation_Position=665; Antisense; GTGTCCTGCCAGGTTATTGAGCCAA
>probe:Drosophila_2:1633343_at:115:519; Interrogation_Position=692; Antisense; GTGGACATTCAGTTCGACTACCATC
>probe:Drosophila_2:1633343_at:700:287; Interrogation_Position=754; Antisense; CGGCAATGTCTTTCTCAACGAGTCT
>probe:Drosophila_2:1633343_at:6:545; Interrogation_Position=781; Antisense; GGACGACGACGGACCTACTTACAAG
>probe:Drosophila_2:1633343_at:590:69; Interrogation_Position=821; Antisense; AGGCGCATCATCAGTGTTCGGTTGA
>probe:Drosophila_2:1633343_at:173:401; Interrogation_Position=866; Antisense; GACATCCAAATCCACTGCAAGGCGT
>probe:Drosophila_2:1633343_at:309:525; Interrogation_Position=891; Antisense; GGGCTAAGAACATACCGCTCCATAT
>probe:Drosophila_2:1633343_at:513:651; Interrogation_Position=924; Antisense; TCAAGATGCTGGTGCGTCTGACGGC
>probe:Drosophila_2:1633343_at:345:203; Interrogation_Position=961; Antisense; AACCACTCCATTGGTGCTGGACGAG

Paste this into a BLAST search page for me
ACGATACGGTCTCGAAGGCCCGAAGGGCACGCCGTGCATTCTAATAAAGAAGGCATTGGGCTTCCAGGCGGTAACGGTAACCTACGATGACGCCCTAACGCTCCGGATGAGCTATTCGACTATGTGTGTCCTGCCAGGTTATTGAGCCAAGTGGACATTCAGTTCGACTACCATCCGGCAATGTCTTTCTCAACGAGTCTGGACGACGACGGACCTACTTACAAGAGGCGCATCATCAGTGTTCGGTTGAGACATCCAAATCCACTGCAAGGCGTGGGCTAAGAACATACCGCTCCATATTCAAGATGCTGGTGCGTCTGACGGCAACCACTCCATTGGTGCTGGACGAG

Full Affymetrix probeset data:

Annotations for 1633343_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720