Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633344_at:

>probe:Drosophila_2:1633344_at:314:77; Interrogation_Position=1278; Antisense; AGGATGATGGCCAGTACCACGCGCA
>probe:Drosophila_2:1633344_at:398:259; Interrogation_Position=1295; Antisense; CACGCGCACTATGACCACTATTAAG
>probe:Drosophila_2:1633344_at:593:475; Interrogation_Position=1346; Antisense; GTTTAACTTCCGATCGACGACGAGC
>probe:Drosophila_2:1633344_at:103:117; Interrogation_Position=1368; Antisense; AGCATCTCTATACACTCTGACTAAC
>probe:Drosophila_2:1633344_at:647:655; Interrogation_Position=1389; Antisense; TAACCGACTACCGAAGCCAGCGTGG
>probe:Drosophila_2:1633344_at:141:493; Interrogation_Position=1421; Antisense; GTAACGTTGCATTGCGTATTCGCTC
>probe:Drosophila_2:1633344_at:398:311; Interrogation_Position=1452; Antisense; GCCACTTTTATACAGCATTCGCAAC
>probe:Drosophila_2:1633344_at:629:359; Interrogation_Position=1472; Antisense; GCAACTCTCTGTCTTTCTATACATT
>probe:Drosophila_2:1633344_at:29:667; Interrogation_Position=1509; Antisense; TACTGCTTCTATTTCTTAACCTCTG
>probe:Drosophila_2:1633344_at:602:539; Interrogation_Position=1555; Antisense; TGAAAGCTACTACACACGGGAGATT
>probe:Drosophila_2:1633344_at:188:717; Interrogation_Position=1604; Antisense; TTGCCCGCTGGGTTTTGACCGATTT
>probe:Drosophila_2:1633344_at:270:543; Interrogation_Position=1629; Antisense; GGATTTTCGATCCAGTCACAGCACA
>probe:Drosophila_2:1633344_at:623:713; Interrogation_Position=1681; Antisense; TTCTCTCTGTACTAGGATTTTCCCT
>probe:Drosophila_2:1633344_at:401:37; Interrogation_Position=1714; Antisense; ATCTATATCTTTATCCTCCTGTTAC

Paste this into a BLAST search page for me
AGGATGATGGCCAGTACCACGCGCACACGCGCACTATGACCACTATTAAGGTTTAACTTCCGATCGACGACGAGCAGCATCTCTATACACTCTGACTAACTAACCGACTACCGAAGCCAGCGTGGGTAACGTTGCATTGCGTATTCGCTCGCCACTTTTATACAGCATTCGCAACGCAACTCTCTGTCTTTCTATACATTTACTGCTTCTATTTCTTAACCTCTGTGAAAGCTACTACACACGGGAGATTTTGCCCGCTGGGTTTTGACCGATTTGGATTTTCGATCCAGTCACAGCACATTCTCTCTGTACTAGGATTTTCCCTATCTATATCTTTATCCTCCTGTTAC

Full Affymetrix probeset data:

Annotations for 1633344_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime