Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633345_at:

>probe:Drosophila_2:1633345_at:720:83; Interrogation_Position=3669; Antisense; AGTGCATTCTAGAACTATCGGTAGT
>probe:Drosophila_2:1633345_at:502:481; Interrogation_Position=3692; Antisense; GTATATGTCAACCTAGATCGTAAGC
>probe:Drosophila_2:1633345_at:490:725; Interrogation_Position=3856; Antisense; TTGTTTCCCCATTTTGTATATTTGT
>probe:Drosophila_2:1633345_at:52:475; Interrogation_Position=3879; Antisense; GTTCAATCTTAGTTTGTACATTTTC
>probe:Drosophila_2:1633345_at:645:599; Interrogation_Position=3893; Antisense; TGTACATTTTCGATTGTGTGTTCAA
>probe:Drosophila_2:1633345_at:267:517; Interrogation_Position=3908; Antisense; GTGTGTTCAATGCAATTGGTCGGAA
>probe:Drosophila_2:1633345_at:587:533; Interrogation_Position=3925; Antisense; GGTCGGAACCATACTGATTTTCGCA
>probe:Drosophila_2:1633345_at:40:527; Interrogation_Position=3990; Antisense; GGGCACTCACAGTCCGCCAGGACAA
>probe:Drosophila_2:1633345_at:711:501; Interrogation_Position=4001; Antisense; GTCCGCCAGGACAAAGTGGGCGCAA
>probe:Drosophila_2:1633345_at:374:515; Interrogation_Position=4016; Antisense; GTGGGCGCAAAATGTTTAACTGCAT
>probe:Drosophila_2:1633345_at:699:229; Interrogation_Position=4026; Antisense; AATGTTTAACTGCATTCCATGTAAA
>probe:Drosophila_2:1633345_at:437:611; Interrogation_Position=4076; Antisense; TGAAATTCGCATGTATGTATACCTT
>probe:Drosophila_2:1633345_at:148:485; Interrogation_Position=4088; Antisense; GTATGTATACCTTAATCTCGGTTCG
>probe:Drosophila_2:1633345_at:665:237; Interrogation_Position=4101; Antisense; AATCTCGGTTCGATTGCCATGGCAA

Paste this into a BLAST search page for me
AGTGCATTCTAGAACTATCGGTAGTGTATATGTCAACCTAGATCGTAAGCTTGTTTCCCCATTTTGTATATTTGTGTTCAATCTTAGTTTGTACATTTTCTGTACATTTTCGATTGTGTGTTCAAGTGTGTTCAATGCAATTGGTCGGAAGGTCGGAACCATACTGATTTTCGCAGGGCACTCACAGTCCGCCAGGACAAGTCCGCCAGGACAAAGTGGGCGCAAGTGGGCGCAAAATGTTTAACTGCATAATGTTTAACTGCATTCCATGTAAATGAAATTCGCATGTATGTATACCTTGTATGTATACCTTAATCTCGGTTCGAATCTCGGTTCGATTGCCATGGCAA

Full Affymetrix probeset data:

Annotations for 1633345_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime