FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633346_at:

>probe:Drosophila_2:1633346_at:141:639; Interrogation_Position=1005; Antisense; TCGTGTATCGCAACCTGTTCAAGAA
>probe:Drosophila_2:1633346_at:359:81; Interrogation_Position=1029; Antisense; AGGTGTTCGTCATCCGGAAATCGCA
>probe:Drosophila_2:1633346_at:45:341; Interrogation_Position=1098; Antisense; GCTTAACCGATGTTTCTCTGGACGA
>probe:Drosophila_2:1633346_at:492:617; Interrogation_Position=1130; Antisense; TGCATCGTGGCCAATCTCATTTACG
>probe:Drosophila_2:1633346_at:40:539; Interrogation_Position=1170; Antisense; GGTACATCTCACATGCTCACAACAA
>probe:Drosophila_2:1633346_at:75:513; Interrogation_Position=1202; Antisense; GTGTCGAAGCAAAATCCATTCCCCT
>probe:Drosophila_2:1633346_at:321:647; Interrogation_Position=1226; Antisense; TCAGTGTCCCTTTAGTGCATTTTGT
>probe:Drosophila_2:1633346_at:349:485; Interrogation_Position=696; Antisense; GTAGACGGGCTATGTTCGACTCCAA
>probe:Drosophila_2:1633346_at:548:671; Interrogation_Position=722; Antisense; TACCAGGCAGCCGTACAGTATCTGT
>probe:Drosophila_2:1633346_at:399:91; Interrogation_Position=738; Antisense; AGTATCTGTCGTATGCCTTTAGCAA
>probe:Drosophila_2:1633346_at:589:647; Interrogation_Position=795; Antisense; TCATCCTCATCTATTTGGTGCCAGT
>probe:Drosophila_2:1633346_at:408:375; Interrogation_Position=820; Antisense; GAAGATGCTGCTGGGATATCTGCCC
>probe:Drosophila_2:1633346_at:217:285; Interrogation_Position=878; Antisense; CTGTTTCTCGATCTGGCTATGGCCA
>probe:Drosophila_2:1633346_at:85:109; Interrogation_Position=990; Antisense; AGAAGCTCAAGTTCCTCGTGTATCG

Paste this into a BLAST search page for me
TCGTGTATCGCAACCTGTTCAAGAAAGGTGTTCGTCATCCGGAAATCGCAGCTTAACCGATGTTTCTCTGGACGATGCATCGTGGCCAATCTCATTTACGGGTACATCTCACATGCTCACAACAAGTGTCGAAGCAAAATCCATTCCCCTTCAGTGTCCCTTTAGTGCATTTTGTGTAGACGGGCTATGTTCGACTCCAATACCAGGCAGCCGTACAGTATCTGTAGTATCTGTCGTATGCCTTTAGCAATCATCCTCATCTATTTGGTGCCAGTGAAGATGCTGCTGGGATATCTGCCCCTGTTTCTCGATCTGGCTATGGCCAAGAAGCTCAAGTTCCTCGTGTATCG

Full Affymetrix probeset data:

Annotations for 1633346_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720