FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633347_at:

>probe:Drosophila_2:1633347_at:380:665; Interrogation_Position=121; Antisense; TAAATATGGCCAACCTGGACGTGAA
>probe:Drosophila_2:1633347_at:696:455; Interrogation_Position=155; Antisense; GATAAACCATTTGCGGTGCTGGAAA
>probe:Drosophila_2:1633347_at:575:175; Interrogation_Position=16; Antisense; AAACGCTGGCAAAGGCGATTGGGCC
>probe:Drosophila_2:1633347_at:321:423; Interrogation_Position=198; Antisense; GAGAACGACTCCTAGAAACGAGCAT
>probe:Drosophila_2:1633347_at:670:115; Interrogation_Position=218; Antisense; AGCATGGCCTCGCAGGATGTCAGTA
>probe:Drosophila_2:1633347_at:258:443; Interrogation_Position=233; Antisense; GATGTCAGTATGCTGAACGCCACCA
>probe:Drosophila_2:1633347_at:213:417; Interrogation_Position=266; Antisense; GAGCGCACAGTGCTGGATCATACGA
>probe:Drosophila_2:1633347_at:635:543; Interrogation_Position=280; Antisense; GGATCATACGATCGCCCAGGAGCAC
>probe:Drosophila_2:1633347_at:526:321; Interrogation_Position=293; Antisense; GCCCAGGAGCACAAGAGTCGCCAAA
>probe:Drosophila_2:1633347_at:126:325; Interrogation_Position=30; Antisense; GCGATTGGGCCATTATAGAGCTGCA
>probe:Drosophila_2:1633347_at:649:431; Interrogation_Position=307; Antisense; GAGTCGCCAAAGAACGGAGTACACT
>probe:Drosophila_2:1633347_at:592:273; Interrogation_Position=40; Antisense; CATTATAGAGCTGCAAGGCGACCTG
>probe:Drosophila_2:1633347_at:317:129; Interrogation_Position=78; Antisense; ACCAGGATATGCACGGCCAGTTTAT
>probe:Drosophila_2:1633347_at:21:267; Interrogation_Position=95; Antisense; CAGTTTATTGGCGATCTCTACTACA

Paste this into a BLAST search page for me
TAAATATGGCCAACCTGGACGTGAAGATAAACCATTTGCGGTGCTGGAAAAAACGCTGGCAAAGGCGATTGGGCCGAGAACGACTCCTAGAAACGAGCATAGCATGGCCTCGCAGGATGTCAGTAGATGTCAGTATGCTGAACGCCACCAGAGCGCACAGTGCTGGATCATACGAGGATCATACGATCGCCCAGGAGCACGCCCAGGAGCACAAGAGTCGCCAAAGCGATTGGGCCATTATAGAGCTGCAGAGTCGCCAAAGAACGGAGTACACTCATTATAGAGCTGCAAGGCGACCTGACCAGGATATGCACGGCCAGTTTATCAGTTTATTGGCGATCTCTACTACA

Full Affymetrix probeset data:

Annotations for 1633347_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720