FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633349_at:

>probe:Drosophila_2:1633349_at:465:363; Interrogation_Position=1022; Antisense; GAATATCGCCACTACAAGACTGAAG
>probe:Drosophila_2:1633349_at:520:647; Interrogation_Position=1070; Antisense; TCAGGCAGCAGCGACTCGGAGTAGC
>probe:Drosophila_2:1633349_at:403:487; Interrogation_Position=1090; Antisense; GTAGCATTGGGAGAATCGCCGACTT
>probe:Drosophila_2:1633349_at:633:363; Interrogation_Position=1102; Antisense; GAATCGCCGACTTACTTTCATTAAA
>probe:Drosophila_2:1633349_at:49:619; Interrogation_Position=1141; Antisense; TGCATGGTTCCGTTTTATTCCTTAA
>probe:Drosophila_2:1633349_at:426:677; Interrogation_Position=1219; Antisense; TAGACACTAGCTTGCACTCTGGTAA
>probe:Drosophila_2:1633349_at:93:121; Interrogation_Position=696; Antisense; AGCTGGAGTCCATACGCAAGGCATC
>probe:Drosophila_2:1633349_at:124:227; Interrogation_Position=713; Antisense; AAGGCATCGGAACCACAGCGACGTG
>probe:Drosophila_2:1633349_at:35:409; Interrogation_Position=732; Antisense; GACGTGTGCAGCCTATCGACAAAAT
>probe:Drosophila_2:1633349_at:281:213; Interrogation_Position=780; Antisense; AAGACCACGCACACAACATTGAATA
>probe:Drosophila_2:1633349_at:108:513; Interrogation_Position=857; Antisense; GTGATGGATATGCTCTTCCACGCAT
>probe:Drosophila_2:1633349_at:414:721; Interrogation_Position=872; Antisense; TTCCACGCATTCGAGAAGCATCAAT
>probe:Drosophila_2:1633349_at:509:251; Interrogation_Position=928; Antisense; CAACCAGCCGATTAGCTACCTGAAG
>probe:Drosophila_2:1633349_at:133:463; Interrogation_Position=955; Antisense; GATTCTCAAGGATGTCTGCGATTAC

Paste this into a BLAST search page for me
GAATATCGCCACTACAAGACTGAAGTCAGGCAGCAGCGACTCGGAGTAGCGTAGCATTGGGAGAATCGCCGACTTGAATCGCCGACTTACTTTCATTAAATGCATGGTTCCGTTTTATTCCTTAATAGACACTAGCTTGCACTCTGGTAAAGCTGGAGTCCATACGCAAGGCATCAAGGCATCGGAACCACAGCGACGTGGACGTGTGCAGCCTATCGACAAAATAAGACCACGCACACAACATTGAATAGTGATGGATATGCTCTTCCACGCATTTCCACGCATTCGAGAAGCATCAATCAACCAGCCGATTAGCTACCTGAAGGATTCTCAAGGATGTCTGCGATTAC

Full Affymetrix probeset data:

Annotations for 1633349_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720