FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633351_at:

>probe:Drosophila_2:1633351_at:485:413; Interrogation_Position=1155; Antisense; GACCATCAACATAGGTGGCGGCCTG
>probe:Drosophila_2:1633351_at:155:563; Interrogation_Position=1216; Antisense; GGAATGAACCCCACAAAGCGCACGG
>probe:Drosophila_2:1633351_at:484:173; Interrogation_Position=1230; Antisense; AAAGCGCACGGTGATGAGCCTGCTG
>probe:Drosophila_2:1633351_at:152:535; Interrogation_Position=1302; Antisense; GGTGACGGCCACCAGTTTCGCTGAA
>probe:Drosophila_2:1633351_at:45:697; Interrogation_Position=1317; Antisense; TTTCGCTGAACCCTTGCAGATGCTG
>probe:Drosophila_2:1633351_at:224:47; Interrogation_Position=1384; Antisense; ATCCTGGCGCTGTCGAAGGAGAGCC
>probe:Drosophila_2:1633351_at:308:349; Interrogation_Position=1413; Antisense; GCAGGGCGTCTAACCCAGTGAGCTG
>probe:Drosophila_2:1633351_at:407:621; Interrogation_Position=1445; Antisense; TGCGGCTGCCCAGATAGACCAATCT
>probe:Drosophila_2:1633351_at:282:677; Interrogation_Position=1459; Antisense; TAGACCAATCTGACCGAATACCACC
>probe:Drosophila_2:1633351_at:95:447; Interrogation_Position=1563; Antisense; GATGCGTACTTGTACTTGTACTCTC
>probe:Drosophila_2:1633351_at:439:487; Interrogation_Position=1580; Antisense; GTACTCTCCCCGTAGTAAGGCTATA
>probe:Drosophila_2:1633351_at:11:223; Interrogation_Position=1596; Antisense; AAGGCTATACCGATCTTTAGGGACT
>probe:Drosophila_2:1633351_at:11:197; Interrogation_Position=1621; Antisense; AACTGTGAACTTATCCGAGCGAATC
>probe:Drosophila_2:1633351_at:369:367; Interrogation_Position=1641; Antisense; GAATCTCGAGCTCGTGCTACACGAT

Paste this into a BLAST search page for me
GACCATCAACATAGGTGGCGGCCTGGGAATGAACCCCACAAAGCGCACGGAAAGCGCACGGTGATGAGCCTGCTGGGTGACGGCCACCAGTTTCGCTGAATTTCGCTGAACCCTTGCAGATGCTGATCCTGGCGCTGTCGAAGGAGAGCCGCAGGGCGTCTAACCCAGTGAGCTGTGCGGCTGCCCAGATAGACCAATCTTAGACCAATCTGACCGAATACCACCGATGCGTACTTGTACTTGTACTCTCGTACTCTCCCCGTAGTAAGGCTATAAAGGCTATACCGATCTTTAGGGACTAACTGTGAACTTATCCGAGCGAATCGAATCTCGAGCTCGTGCTACACGAT

Full Affymetrix probeset data:

Annotations for 1633351_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720