Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633354_at:

>probe:Drosophila_2:1633354_at:541:729; Interrogation_Position=1641; Antisense; TTGGCCAAACAACCCCTGATGCAGT
>probe:Drosophila_2:1633354_at:540:241; Interrogation_Position=1682; Antisense; AATACGTGAGGCTTTCGCCAGCAAT
>probe:Drosophila_2:1633354_at:445:549; Interrogation_Position=1766; Antisense; GGAGGAGACTCTGCGCAAGTATCCA
>probe:Drosophila_2:1633354_at:361:361; Interrogation_Position=1780; Antisense; GCAAGTATCCAATTGTGCCACTCTT
>probe:Drosophila_2:1633354_at:525:123; Interrogation_Position=1807; Antisense; AGCGCGAGTGCACGCCGATTAACAA
>probe:Drosophila_2:1633354_at:438:211; Interrogation_Position=1830; Antisense; AAGAAGCGCTTCTACTCGCTGAGGC
>probe:Drosophila_2:1633354_at:706:49; Interrogation_Position=1884; Antisense; ATGCCCGTGTTCATATCCAATCTGG
>probe:Drosophila_2:1633354_at:595:271; Interrogation_Position=1914; Antisense; CATCACGATCCTAAGTACTGGCCGG
>probe:Drosophila_2:1633354_at:114:133; Interrogation_Position=1954; Antisense; ACCCGGAGCGCTTTAGTGCGGCGAA
>probe:Drosophila_2:1633354_at:126:31; Interrogation_Position=2064; Antisense; ATAAAGCTGGGCCTCGTTTACTTCT
>probe:Drosophila_2:1633354_at:87:723; Interrogation_Position=2088; Antisense; TTGCACCAACATCGCGTCGAGATTT
>probe:Drosophila_2:1633354_at:423:543; Interrogation_Position=2131; Antisense; GGATTCAATTCGACGCCAAGTTCGC
>probe:Drosophila_2:1633354_at:270:217; Interrogation_Position=2148; Antisense; AAGTTCGCGCTGCTAGCCAGTGAGC
>probe:Drosophila_2:1633354_at:513:685; Interrogation_Position=2179; Antisense; TATACCTCAAGGTCGACTGCTTATA

Paste this into a BLAST search page for me
TTGGCCAAACAACCCCTGATGCAGTAATACGTGAGGCTTTCGCCAGCAATGGAGGAGACTCTGCGCAAGTATCCAGCAAGTATCCAATTGTGCCACTCTTAGCGCGAGTGCACGCCGATTAACAAAAGAAGCGCTTCTACTCGCTGAGGCATGCCCGTGTTCATATCCAATCTGGCATCACGATCCTAAGTACTGGCCGGACCCGGAGCGCTTTAGTGCGGCGAAATAAAGCTGGGCCTCGTTTACTTCTTTGCACCAACATCGCGTCGAGATTTGGATTCAATTCGACGCCAAGTTCGCAAGTTCGCGCTGCTAGCCAGTGAGCTATACCTCAAGGTCGACTGCTTATA

Full Affymetrix probeset data:

Annotations for 1633354_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime