FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633355_at:

>probe:Drosophila_2:1633355_at:22:329; Interrogation_Position=1006; Antisense; GCGTCTCTGCGATTTGCCCAAAAAG
>probe:Drosophila_2:1633355_at:41:451; Interrogation_Position=1031; Antisense; GATCGTCCGAAATATTTCTCTCTCC
>probe:Drosophila_2:1633355_at:669:569; Interrogation_Position=1067; Antisense; GGCATCGAGGTGGACTTCATCAACA
>probe:Drosophila_2:1633355_at:558:711; Interrogation_Position=1082; Antisense; TTCATCAACACATTCTTGCGGGCGG
>probe:Drosophila_2:1633355_at:32:371; Interrogation_Position=1112; Antisense; GAAGGAATCTTCTACTTTCTCACTG
>probe:Drosophila_2:1633355_at:251:669; Interrogation_Position=1124; Antisense; TACTTTCTCACTGTTTCCGAGAGCG
>probe:Drosophila_2:1633355_at:534:631; Interrogation_Position=1139; Antisense; TCCGAGAGCGTTTTTGCTGGCAGCA
>probe:Drosophila_2:1633355_at:89:535; Interrogation_Position=1180; Antisense; GGTGCTGCGCGGAGATCCAGAAATT
>probe:Drosophila_2:1633355_at:169:651; Interrogation_Position=1284; Antisense; TCAACAACTTGGCTAGACTGCAGGA
>probe:Drosophila_2:1633355_at:117:215; Interrogation_Position=1343; Antisense; AAGAGGATCATCGAAGCCGCTCCTG
>probe:Drosophila_2:1633355_at:451:221; Interrogation_Position=894; Antisense; AAGGTGGACCCGGTCAGCACTTGGA
>probe:Drosophila_2:1633355_at:166:497; Interrogation_Position=906; Antisense; GTCAGCACTTGGAGCTTGTCCAGAA
>probe:Drosophila_2:1633355_at:673:501; Interrogation_Position=954; Antisense; GTCGAAAGTACTTCCAGCAGCTGCT
>probe:Drosophila_2:1633355_at:261:111; Interrogation_Position=969; Antisense; AGCAGCTGCTTAAACGTTACGCCAC

Paste this into a BLAST search page for me
GCGTCTCTGCGATTTGCCCAAAAAGGATCGTCCGAAATATTTCTCTCTCCGGCATCGAGGTGGACTTCATCAACATTCATCAACACATTCTTGCGGGCGGGAAGGAATCTTCTACTTTCTCACTGTACTTTCTCACTGTTTCCGAGAGCGTCCGAGAGCGTTTTTGCTGGCAGCAGGTGCTGCGCGGAGATCCAGAAATTTCAACAACTTGGCTAGACTGCAGGAAAGAGGATCATCGAAGCCGCTCCTGAAGGTGGACCCGGTCAGCACTTGGAGTCAGCACTTGGAGCTTGTCCAGAAGTCGAAAGTACTTCCAGCAGCTGCTAGCAGCTGCTTAAACGTTACGCCAC

Full Affymetrix probeset data:

Annotations for 1633355_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720