FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633357_at:

>probe:Drosophila_2:1633357_at:98:513; Interrogation_Position=1435; Antisense; GTGATCCATCGATGCGTTTGCTGAT
>probe:Drosophila_2:1633357_at:699:519; Interrogation_Position=1461; Antisense; GTGGAACTCTTCAACAGCATCATAG
>probe:Drosophila_2:1633357_at:188:345; Interrogation_Position=1477; Antisense; GCATCATAGGTCACTCAATCTTCAC
>probe:Drosophila_2:1633357_at:336:377; Interrogation_Position=1529; Antisense; GAAGCGATTCAACGGCCTTATGGCC
>probe:Drosophila_2:1633357_at:351:209; Interrogation_Position=1567; Antisense; AAGAATACCGAGTTGAGGCCCAGAA
>probe:Drosophila_2:1633357_at:240:39; Interrogation_Position=1603; Antisense; ATCTGAATCAATTGCTTGGTACCCA
>probe:Drosophila_2:1633357_at:222:729; Interrogation_Position=1618; Antisense; TTGGTACCCAAGGAGTCCTCATCAT
>probe:Drosophila_2:1633357_at:165:681; Interrogation_Position=1666; Antisense; TATGTTTTCACACCTCGCTGTTAAA
>probe:Drosophila_2:1633357_at:487:621; Interrogation_Position=1714; Antisense; TGCTGTTCAACATCCTTGGTCTGCC
>probe:Drosophila_2:1633357_at:76:533; Interrogation_Position=1796; Antisense; GGTGGCCGCCCAATATCAGGACAAA
>probe:Drosophila_2:1633357_at:43:391; Interrogation_Position=1815; Antisense; GACAAACTCTGCCTGAAGGTCGCCG
>probe:Drosophila_2:1633357_at:556:369; Interrogation_Position=1842; Antisense; GAACTGGAGGCCGTTTTTCACGGCT
>probe:Drosophila_2:1633357_at:217:593; Interrogation_Position=1866; Antisense; TGGGTGCCACCGGTACCACATGACA
>probe:Drosophila_2:1633357_at:184:539; Interrogation_Position=1916; Antisense; GGTACCTGCTCAGTTTTCCATTTAA

Paste this into a BLAST search page for me
GTGATCCATCGATGCGTTTGCTGATGTGGAACTCTTCAACAGCATCATAGGCATCATAGGTCACTCAATCTTCACGAAGCGATTCAACGGCCTTATGGCCAAGAATACCGAGTTGAGGCCCAGAAATCTGAATCAATTGCTTGGTACCCATTGGTACCCAAGGAGTCCTCATCATTATGTTTTCACACCTCGCTGTTAAATGCTGTTCAACATCCTTGGTCTGCCGGTGGCCGCCCAATATCAGGACAAAGACAAACTCTGCCTGAAGGTCGCCGGAACTGGAGGCCGTTTTTCACGGCTTGGGTGCCACCGGTACCACATGACAGGTACCTGCTCAGTTTTCCATTTAA

Full Affymetrix probeset data:

Annotations for 1633357_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720