FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633360_at:

>probe:Drosophila_2:1633360_at:596:391; Interrogation_Position=113; Antisense; GAAACCGATTGCAGACAGCCATAAT
>probe:Drosophila_2:1633360_at:302:125; Interrogation_Position=129; Antisense; AGCCATAATTCTCTTTGTCACTCAG
>probe:Drosophila_2:1633360_at:55:615; Interrogation_Position=14; Antisense; TGAAGCTAACACTGCGACGCTACTC
>probe:Drosophila_2:1633360_at:163:547; Interrogation_Position=153; Antisense; GGATGCCCTGATTATCGCGGAGTAC
>probe:Drosophila_2:1633360_at:181:343; Interrogation_Position=198; Antisense; GCACTCGACGTGTGTGTACCAGGTC
>probe:Drosophila_2:1633360_at:689:563; Interrogation_Position=245; Antisense; GGAATTGCAAGCTCTTCATGGCCAG
>probe:Drosophila_2:1633360_at:555:589; Interrogation_Position=310; Antisense; TGGATCATCTACCAATACCGTCAGC
>probe:Drosophila_2:1633360_at:316:75; Interrogation_Position=344; Antisense; AGGACGGTCATCATTGGCCACTGGG
>probe:Drosophila_2:1633360_at:616:123; Interrogation_Position=392; Antisense; AGCGCATCATGTCGGTTTTCTATTA
>probe:Drosophila_2:1633360_at:660:689; Interrogation_Position=412; Antisense; TATTACTACAGCTCCAAGTCGACGG
>probe:Drosophila_2:1633360_at:195:219; Interrogation_Position=427; Antisense; AAGTCGACGGCTCTGACCATGGCAG
>probe:Drosophila_2:1633360_at:51:269; Interrogation_Position=444; Antisense; CATGGCAGATCCTCGCTTCAAGGAG
>probe:Drosophila_2:1633360_at:70:77; Interrogation_Position=467; Antisense; AGGAGCATCTTGACTGGATCGCAGA
>probe:Drosophila_2:1633360_at:266:591; Interrogation_Position=68; Antisense; TGGGAGTGGACCTCTTTTGCAACGC

Paste this into a BLAST search page for me
GAAACCGATTGCAGACAGCCATAATAGCCATAATTCTCTTTGTCACTCAGTGAAGCTAACACTGCGACGCTACTCGGATGCCCTGATTATCGCGGAGTACGCACTCGACGTGTGTGTACCAGGTCGGAATTGCAAGCTCTTCATGGCCAGTGGATCATCTACCAATACCGTCAGCAGGACGGTCATCATTGGCCACTGGGAGCGCATCATGTCGGTTTTCTATTATATTACTACAGCTCCAAGTCGACGGAAGTCGACGGCTCTGACCATGGCAGCATGGCAGATCCTCGCTTCAAGGAGAGGAGCATCTTGACTGGATCGCAGATGGGAGTGGACCTCTTTTGCAACGC

Full Affymetrix probeset data:

Annotations for 1633360_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720