FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633361_at:

>probe:Drosophila_2:1633361_at:277:123; Interrogation_Position=1005; Antisense; AGCGATGTGATGATGGCGGCCCCAA
>probe:Drosophila_2:1633361_at:76:331; Interrogation_Position=1109; Antisense; GCAGGGCCTGGTCAAAATATCTAAC
>probe:Drosophila_2:1633361_at:712:23; Interrogation_Position=1156; Antisense; ATATGGCCCGTATATCGACGCAGAT
>probe:Drosophila_2:1633361_at:696:409; Interrogation_Position=1172; Antisense; GACGCAGATGAACTGATCCCATTAC
>probe:Drosophila_2:1633361_at:301:183; Interrogation_Position=1199; Antisense; AAAACCCATGGCTACTGGTCACAAA
>probe:Drosophila_2:1633361_at:291:487; Interrogation_Position=1235; Antisense; GTAGCTTAGCTAGCAGGATTGCCAA
>probe:Drosophila_2:1633361_at:11:307; Interrogation_Position=1282; Antisense; CCTGCACTCCTGCTGGTTAGAGATA
>probe:Drosophila_2:1633361_at:692:515; Interrogation_Position=1367; Antisense; GTGGTCAACTTCTCAAAAACTCTAT
>probe:Drosophila_2:1633361_at:321:421; Interrogation_Position=829; Antisense; GAGCACCGCCAGATGGAGACCTGGT
>probe:Drosophila_2:1633361_at:279:541; Interrogation_Position=874; Antisense; GGTTAACCCAGATCGACAGCACGTT
>probe:Drosophila_2:1633361_at:124:263; Interrogation_Position=890; Antisense; CAGCACGTTGTGCTCGATTAGCGAG
>probe:Drosophila_2:1633361_at:68:439; Interrogation_Position=912; Antisense; GAGGAATTCCAGGAGCCGCAGCTGA
>probe:Drosophila_2:1633361_at:712:319; Interrogation_Position=926; Antisense; GCCGCAGCTGAGTTTCGCAGAGCGA
>probe:Drosophila_2:1633361_at:33:103; Interrogation_Position=944; Antisense; AGAGCGACGCAAGATTTCCCAGGAG

Paste this into a BLAST search page for me
AGCGATGTGATGATGGCGGCCCCAAGCAGGGCCTGGTCAAAATATCTAACATATGGCCCGTATATCGACGCAGATGACGCAGATGAACTGATCCCATTACAAAACCCATGGCTACTGGTCACAAAGTAGCTTAGCTAGCAGGATTGCCAACCTGCACTCCTGCTGGTTAGAGATAGTGGTCAACTTCTCAAAAACTCTATGAGCACCGCCAGATGGAGACCTGGTGGTTAACCCAGATCGACAGCACGTTCAGCACGTTGTGCTCGATTAGCGAGGAGGAATTCCAGGAGCCGCAGCTGAGCCGCAGCTGAGTTTCGCAGAGCGAAGAGCGACGCAAGATTTCCCAGGAG

Full Affymetrix probeset data:

Annotations for 1633361_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720