Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633362_at:

>probe:Drosophila_2:1633362_at:122:719; Interrogation_Position=1007; Antisense; TTCCCATTACGCAGGCAACGCTATC
>probe:Drosophila_2:1633362_at:693:133; Interrogation_Position=1024; Antisense; ACGCTATCCGGCGTCGATAAGCAAA
>probe:Drosophila_2:1633362_at:237:169; Interrogation_Position=1046; Antisense; AAATGGAGCACACCCTTTTCGATGT
>probe:Drosophila_2:1633362_at:272:589; Interrogation_Position=1070; Antisense; TGGAGGCCCTGCAGGAGTACATCCT
>probe:Drosophila_2:1633362_at:295:101; Interrogation_Position=1112; Antisense; AGAGCGGCGGGCTTATCGACAAACC
>probe:Drosophila_2:1633362_at:430:561; Interrogation_Position=1138; Antisense; GGAAAACCGCAGGATCTCTACCACA
>probe:Drosophila_2:1633362_at:722:643; Interrogation_Position=1154; Antisense; TCTACCACACATGCTATACTCTTAG
>probe:Drosophila_2:1633362_at:324:341; Interrogation_Position=1166; Antisense; GCTATACTCTTAGTGGCGTTTCCAT
>probe:Drosophila_2:1633362_at:179:79; Interrogation_Position=1223; Antisense; AGGTCCTGGGCGACACCATTAACGA
>probe:Drosophila_2:1633362_at:547:601; Interrogation_Position=1268; Antisense; TGTTCAACATCCCACCAAAGTCAGT
>probe:Drosophila_2:1633362_at:32:219; Interrogation_Position=1285; Antisense; AAGTCAGTTGCAGCTGCCAGGAGCC
>probe:Drosophila_2:1633362_at:501:415; Interrogation_Position=1305; Antisense; GAGCCACTTCAGCAATTCCAATGAC
>probe:Drosophila_2:1633362_at:543:589; Interrogation_Position=1406; Antisense; TGAGGACGTTTTGCTGGTGGTTTAC
>probe:Drosophila_2:1633362_at:506:243; Interrogation_Position=1471; Antisense; AATATTGTATTTTTCGCTTCTTGTA

Paste this into a BLAST search page for me
TTCCCATTACGCAGGCAACGCTATCACGCTATCCGGCGTCGATAAGCAAAAAATGGAGCACACCCTTTTCGATGTTGGAGGCCCTGCAGGAGTACATCCTAGAGCGGCGGGCTTATCGACAAACCGGAAAACCGCAGGATCTCTACCACATCTACCACACATGCTATACTCTTAGGCTATACTCTTAGTGGCGTTTCCATAGGTCCTGGGCGACACCATTAACGATGTTCAACATCCCACCAAAGTCAGTAAGTCAGTTGCAGCTGCCAGGAGCCGAGCCACTTCAGCAATTCCAATGACTGAGGACGTTTTGCTGGTGGTTTACAATATTGTATTTTTCGCTTCTTGTA

Full Affymetrix probeset data:

Annotations for 1633362_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime