Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633363_at:

>probe:Drosophila_2:1633363_at:244:267; Interrogation_Position=2070; Antisense; CAGGACGGCCTTGCACGTGGCAGCA
>probe:Drosophila_2:1633363_at:708:583; Interrogation_Position=2087; Antisense; TGGCAGCACTGCACGGATTTCCGGA
>probe:Drosophila_2:1633363_at:228:17; Interrogation_Position=2103; Antisense; ATTTCCGGAGGTGGTGCAATACGTC
>probe:Drosophila_2:1633363_at:356:29; Interrogation_Position=2121; Antisense; ATACGTCCTGCCCTATTTCGAGAAT
>probe:Drosophila_2:1633363_at:656:109; Interrogation_Position=2153; Antisense; AGAAGGACATGCTCGGCCTGACCGC
>probe:Drosophila_2:1633363_at:502:259; Interrogation_Position=2203; Antisense; CACGCAGCGGTTATGGAGGTCCTAA
>probe:Drosophila_2:1633363_at:590:395; Interrogation_Position=2235; Antisense; GAAATCTCTTCCGAACCATACATAC
>probe:Drosophila_2:1633363_at:375:201; Interrogation_Position=2248; Antisense; AACCATACATACCTCGTTCCTTGTT
>probe:Drosophila_2:1633363_at:589:469; Interrogation_Position=2263; Antisense; GTTCCTTGTTCCTGCAGCATGAAGA
>probe:Drosophila_2:1633363_at:120:259; Interrogation_Position=2298; Antisense; CACTGGAGGCTAGGGTTATTTCTTT
>probe:Drosophila_2:1633363_at:143:469; Interrogation_Position=2334; Antisense; GTTGCATCTAGTCTAATGGTTCCTT
>probe:Drosophila_2:1633363_at:169:541; Interrogation_Position=2351; Antisense; GGTTCCTTATTATCAGTTTTGCATA
>probe:Drosophila_2:1633363_at:496:13; Interrogation_Position=2414; Antisense; ATTAAGTGTCGAATCCCTGACCTGT
>probe:Drosophila_2:1633363_at:174:363; Interrogation_Position=2424; Antisense; GAATCCCTGACCTGTTTTTAAGTAG

Paste this into a BLAST search page for me
CAGGACGGCCTTGCACGTGGCAGCATGGCAGCACTGCACGGATTTCCGGAATTTCCGGAGGTGGTGCAATACGTCATACGTCCTGCCCTATTTCGAGAATAGAAGGACATGCTCGGCCTGACCGCCACGCAGCGGTTATGGAGGTCCTAAGAAATCTCTTCCGAACCATACATACAACCATACATACCTCGTTCCTTGTTGTTCCTTGTTCCTGCAGCATGAAGACACTGGAGGCTAGGGTTATTTCTTTGTTGCATCTAGTCTAATGGTTCCTTGGTTCCTTATTATCAGTTTTGCATAATTAAGTGTCGAATCCCTGACCTGTGAATCCCTGACCTGTTTTTAAGTAG

Full Affymetrix probeset data:

Annotations for 1633363_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime