Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633364_at:

>probe:Drosophila_2:1633364_at:155:517; Interrogation_Position=127; Antisense; GTGGACCCGGTGAACCATAGTCCTG
>probe:Drosophila_2:1633364_at:650:107; Interrogation_Position=209; Antisense; AGAAGGACGATCAGAACGCCCTCTC
>probe:Drosophila_2:1633364_at:496:597; Interrogation_Position=21; Antisense; TGTGCACTCTGTTTGGAGCTACCTA
>probe:Drosophila_2:1633364_at:521:465; Interrogation_Position=271; Antisense; GTTGGAGCCATGGACTGTCACAGCC
>probe:Drosophila_2:1633364_at:63:33; Interrogation_Position=322; Antisense; ATAAGATTGTACTCGCAGCGGTTGC
>probe:Drosophila_2:1633364_at:533:483; Interrogation_Position=377; Antisense; GTATCGCACCAAAAGGTCTCCTTAA
>probe:Drosophila_2:1633364_at:503:601; Interrogation_Position=405; Antisense; TGTACCAAGCCATCAGTTCTATCTG
>probe:Drosophila_2:1633364_at:700:471; Interrogation_Position=420; Antisense; GTTCTATCTGTCTAAGCCAACCTAT
>probe:Drosophila_2:1633364_at:85:205; Interrogation_Position=433; Antisense; AAGCCAACCTATCCAGATGACACTG
>probe:Drosophila_2:1633364_at:88:111; Interrogation_Position=479; Antisense; AGAAGGCACACATCAGTGTCTCGCA
>probe:Drosophila_2:1633364_at:9:517; Interrogation_Position=494; Antisense; GTGTCTCGCACATACAGATCGACCA
>probe:Drosophila_2:1633364_at:69:257; Interrogation_Position=517; Antisense; CACAAAGAGGCCGTGGTTGTTCCCT
>probe:Drosophila_2:1633364_at:340:359; Interrogation_Position=56; Antisense; GCAACTGCTGGCAATGCACCGAAGA
>probe:Drosophila_2:1633364_at:335:375; Interrogation_Position=76; Antisense; GAAGATCCAGGTGCGCAGCCCAACG

Paste this into a BLAST search page for me
GTGGACCCGGTGAACCATAGTCCTGAGAAGGACGATCAGAACGCCCTCTCTGTGCACTCTGTTTGGAGCTACCTAGTTGGAGCCATGGACTGTCACAGCCATAAGATTGTACTCGCAGCGGTTGCGTATCGCACCAAAAGGTCTCCTTAATGTACCAAGCCATCAGTTCTATCTGGTTCTATCTGTCTAAGCCAACCTATAAGCCAACCTATCCAGATGACACTGAGAAGGCACACATCAGTGTCTCGCAGTGTCTCGCACATACAGATCGACCACACAAAGAGGCCGTGGTTGTTCCCTGCAACTGCTGGCAATGCACCGAAGAGAAGATCCAGGTGCGCAGCCCAACG

Full Affymetrix probeset data:

Annotations for 1633364_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime