Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633365_at:

>probe:Drosophila_2:1633365_at:730:639; Interrogation_Position=1330; Antisense; TCTGGAATCGTGAAGCACCTGTCTA
>probe:Drosophila_2:1633365_at:489:423; Interrogation_Position=1356; Antisense; GAGAAATCTGCCCAGTGCCGAGATC
>probe:Drosophila_2:1633365_at:175:289; Interrogation_Position=1408; Antisense; CGGCAGCTGAGGAACGGCGACCTAA
>probe:Drosophila_2:1633365_at:523:573; Interrogation_Position=1423; Antisense; GGCGACCTAATGATGACCTACTACA
>probe:Drosophila_2:1633365_at:244:651; Interrogation_Position=1441; Antisense; TACTACATCATGCTTGCCGGTTTCG
>probe:Drosophila_2:1633365_at:78:53; Interrogation_Position=1498; Antisense; ATGTTCCGGTACGTCAATAGTCGCC
>probe:Drosophila_2:1633365_at:451:189; Interrogation_Position=1618; Antisense; AACAGTGGACATGGGCAGCTCCTGG
>probe:Drosophila_2:1633365_at:722:697; Interrogation_Position=1696; Antisense; TTCAACGGCGGCAGTCACGGAGATC
>probe:Drosophila_2:1633365_at:495:551; Interrogation_Position=1714; Antisense; GGAGATCCACTGAATCGCTGGCGAC
>probe:Drosophila_2:1633365_at:273:559; Interrogation_Position=1753; Antisense; GGAAACGCCCTTGGCAATGGTGTCC
>probe:Drosophila_2:1633365_at:217:475; Interrogation_Position=1802; Antisense; GTGTACGGCGCCTGATCAACGGACG
>probe:Drosophila_2:1633365_at:446:553; Interrogation_Position=1822; Antisense; GGACGCGACTACATGGTATTCCGCA
>probe:Drosophila_2:1633365_at:456:539; Interrogation_Position=1836; Antisense; GGTATTCCGCAATCCAAATGGTCAA
>probe:Drosophila_2:1633365_at:532:171; Interrogation_Position=1859; Antisense; AAAGCCAGCTCGTGCCGGTTAGATC

Paste this into a BLAST search page for me
TCTGGAATCGTGAAGCACCTGTCTAGAGAAATCTGCCCAGTGCCGAGATCCGGCAGCTGAGGAACGGCGACCTAAGGCGACCTAATGATGACCTACTACATACTACATCATGCTTGCCGGTTTCGATGTTCCGGTACGTCAATAGTCGCCAACAGTGGACATGGGCAGCTCCTGGTTCAACGGCGGCAGTCACGGAGATCGGAGATCCACTGAATCGCTGGCGACGGAAACGCCCTTGGCAATGGTGTCCGTGTACGGCGCCTGATCAACGGACGGGACGCGACTACATGGTATTCCGCAGGTATTCCGCAATCCAAATGGTCAAAAAGCCAGCTCGTGCCGGTTAGATC

Full Affymetrix probeset data:

Annotations for 1633365_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime