FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633368_at:

>probe:Drosophila_2:1633368_at:13:193; Interrogation_Position=155; Antisense; AACTTTTGGTATTGCCACAGCAGCA
>probe:Drosophila_2:1633368_at:387:255; Interrogation_Position=16; Antisense; CAAAATTGGCAATTGCAGGCGCCCA
>probe:Drosophila_2:1633368_at:635:187; Interrogation_Position=182; Antisense; AACAGCAACATTTGCGAGTGTGCAA
>probe:Drosophila_2:1633368_at:318:327; Interrogation_Position=195; Antisense; GCGAGTGTGCAACAATCAAATCAAT
>probe:Drosophila_2:1633368_at:723:69; Interrogation_Position=32; Antisense; AGGCGCCCAGCTATCAACAACATTT
>probe:Drosophila_2:1633368_at:33:159; Interrogation_Position=341; Antisense; ACAACAACAATCTCGAGGACGATGT
>probe:Drosophila_2:1633368_at:552:649; Interrogation_Position=408; Antisense; TCAACAACAAGTTTCGTTTCTAGGG
>probe:Drosophila_2:1633368_at:558:341; Interrogation_Position=41; Antisense; GCTATCAACAACATTTTCATCATCA
>probe:Drosophila_2:1633368_at:530:531; Interrogation_Position=432; Antisense; GGGTCACCTTACTTTTGTTGATCTG
>probe:Drosophila_2:1633368_at:579:603; Interrogation_Position=447; Antisense; TGTTGATCTGTCTGCCATTCATTAC
>probe:Drosophila_2:1633368_at:528:283; Interrogation_Position=458; Antisense; CTGCCATTCATTACTCACTCAATAT
>probe:Drosophila_2:1633368_at:368:669; Interrogation_Position=469; Antisense; TACTCACTCAATATGGCTAATCTAA
>probe:Drosophila_2:1633368_at:264:571; Interrogation_Position=483; Antisense; GGCTAATCTAAGGTTCAACTTGGGT
>probe:Drosophila_2:1633368_at:340:531; Interrogation_Position=516; Antisense; GGGTAATATCTCACCTACATATGTA

Paste this into a BLAST search page for me
AACTTTTGGTATTGCCACAGCAGCACAAAATTGGCAATTGCAGGCGCCCAAACAGCAACATTTGCGAGTGTGCAAGCGAGTGTGCAACAATCAAATCAATAGGCGCCCAGCTATCAACAACATTTACAACAACAATCTCGAGGACGATGTTCAACAACAAGTTTCGTTTCTAGGGGCTATCAACAACATTTTCATCATCAGGGTCACCTTACTTTTGTTGATCTGTGTTGATCTGTCTGCCATTCATTACCTGCCATTCATTACTCACTCAATATTACTCACTCAATATGGCTAATCTAAGGCTAATCTAAGGTTCAACTTGGGTGGGTAATATCTCACCTACATATGTA

Full Affymetrix probeset data:

Annotations for 1633368_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720