FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633373_at:

>probe:Drosophila_2:1633373_at:553:145; Interrogation_Position=5093; Antisense; ACTCAGCCGGATTTCTTTAACTCAA
>probe:Drosophila_2:1633373_at:725:195; Interrogation_Position=5116; Antisense; AACGGCTTTGCCAAGTTCTACTAGA
>probe:Drosophila_2:1633373_at:632:253; Interrogation_Position=5150; Antisense; CAACATGCAATAAAATCCCCTCGAC
>probe:Drosophila_2:1633373_at:438:57; Interrogation_Position=5208; Antisense; ATGAGAGTGCTCCAACTATGCTGAA
>probe:Drosophila_2:1633373_at:195:371; Interrogation_Position=5230; Antisense; GAAGGACACTACATTGATCACCCAT
>probe:Drosophila_2:1633373_at:531:131; Interrogation_Position=5249; Antisense; ACCCATAGCTCGACAACTTCAGTGA
>probe:Drosophila_2:1633373_at:599:391; Interrogation_Position=5297; Antisense; GAAACCTCTAATAACTCCGGGCATC
>probe:Drosophila_2:1633373_at:647:457; Interrogation_Position=5326; Antisense; GATAGATGACCTTTCAATGCCACAG
>probe:Drosophila_2:1633373_at:87:235; Interrogation_Position=5341; Antisense; AATGCCACAGTTTGAGTCCACGGGT
>probe:Drosophila_2:1633373_at:406:535; Interrogation_Position=5363; Antisense; GGTGCTAGCTCCCAACAGGATATCT
>probe:Drosophila_2:1633373_at:351:283; Interrogation_Position=5390; Antisense; CTGCACGGCTTTCAATCCATGGATA
>probe:Drosophila_2:1633373_at:50:157; Interrogation_Position=5583; Antisense; ACACTTCTCCCAATTCTAGTACTAG
>probe:Drosophila_2:1633373_at:492:63; Interrogation_Position=5633; Antisense; ATGGTTAGCACTAGTTACCCCTACG
>probe:Drosophila_2:1633373_at:298:221; Interrogation_Position=5667; Antisense; AATGCTACAACCGAAAACCCTGCTA

Paste this into a BLAST search page for me
ACTCAGCCGGATTTCTTTAACTCAAAACGGCTTTGCCAAGTTCTACTAGACAACATGCAATAAAATCCCCTCGACATGAGAGTGCTCCAACTATGCTGAAGAAGGACACTACATTGATCACCCATACCCATAGCTCGACAACTTCAGTGAGAAACCTCTAATAACTCCGGGCATCGATAGATGACCTTTCAATGCCACAGAATGCCACAGTTTGAGTCCACGGGTGGTGCTAGCTCCCAACAGGATATCTCTGCACGGCTTTCAATCCATGGATAACACTTCTCCCAATTCTAGTACTAGATGGTTAGCACTAGTTACCCCTACGAATGCTACAACCGAAAACCCTGCTA

Full Affymetrix probeset data:

Annotations for 1633373_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720