Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633375_at:

>probe:Drosophila_2:1633375_at:304:545; Interrogation_Position=2368; Antisense; GGATAAACCATAGGATCTGCTTTTG
>probe:Drosophila_2:1633375_at:590:341; Interrogation_Position=2386; Antisense; GCTTTTGGATCAACTGAAACACTCA
>probe:Drosophila_2:1633375_at:692:389; Interrogation_Position=2401; Antisense; GAAACACTCAATTTTAGACATACAT
>probe:Drosophila_2:1633375_at:65:153; Interrogation_Position=2422; Antisense; ACATGTGTCCATTTTTACTAACTAT
>probe:Drosophila_2:1633375_at:263:27; Interrogation_Position=2445; Antisense; ATACTTCTATTGCATAAGTTCGGCA
>probe:Drosophila_2:1633375_at:112:179; Interrogation_Position=2481; Antisense; AAACTCTCCTTGTAAAACGCTCTCT
>probe:Drosophila_2:1633375_at:671:723; Interrogation_Position=2490; Antisense; TTGTAAAACGCTCTCTACTCTCAGA
>probe:Drosophila_2:1633375_at:371:667; Interrogation_Position=2505; Antisense; TACTCTCAGACTCAGATTGGGATTC
>probe:Drosophila_2:1633375_at:283:727; Interrogation_Position=2521; Antisense; TTGGGATTCGAAACAGCACAATGCA
>probe:Drosophila_2:1633375_at:329:489; Interrogation_Position=2562; Antisense; GTCAATTTTTGACGCATTTACTTTT
>probe:Drosophila_2:1633375_at:649:361; Interrogation_Position=2590; Antisense; GAATTTTTAGCGTATAAGTCTCCAA
>probe:Drosophila_2:1633375_at:203:687; Interrogation_Position=2626; Antisense; TATAGTACTTACTTGTGTCAGTTAT
>probe:Drosophila_2:1633375_at:585:513; Interrogation_Position=2640; Antisense; GTGTCAGTTATTTAGTGGTCAACAA
>probe:Drosophila_2:1633375_at:252:535; Interrogation_Position=2656; Antisense; GGTCAACAAGCCACAGATCAAATTA

Paste this into a BLAST search page for me
GGATAAACCATAGGATCTGCTTTTGGCTTTTGGATCAACTGAAACACTCAGAAACACTCAATTTTAGACATACATACATGTGTCCATTTTTACTAACTATATACTTCTATTGCATAAGTTCGGCAAAACTCTCCTTGTAAAACGCTCTCTTTGTAAAACGCTCTCTACTCTCAGATACTCTCAGACTCAGATTGGGATTCTTGGGATTCGAAACAGCACAATGCAGTCAATTTTTGACGCATTTACTTTTGAATTTTTAGCGTATAAGTCTCCAATATAGTACTTACTTGTGTCAGTTATGTGTCAGTTATTTAGTGGTCAACAAGGTCAACAAGCCACAGATCAAATTA

Full Affymetrix probeset data:

Annotations for 1633375_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime