Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633378_at:

>probe:Drosophila_2:1633378_at:292:149; Interrogation_Position=177; Antisense; ACTTCTTTGGCACGGAGTCCTTGAA
>probe:Drosophila_2:1633378_at:636:503; Interrogation_Position=193; Antisense; GTCCTTGAACTGGTACGAGGCCTAC
>probe:Drosophila_2:1633378_at:453:393; Interrogation_Position=220; Antisense; GAAATGCCGCGAATTGAACTCTGAG
>probe:Drosophila_2:1633378_at:603:383; Interrogation_Position=235; Antisense; GAACTCTGAGCTGGTCACATTCGAA
>probe:Drosophila_2:1633378_at:443:411; Interrogation_Position=263; Antisense; GACCAGGAGTTCGATGCCGTTACGG
>probe:Drosophila_2:1633378_at:417:545; Interrogation_Position=305; Antisense; GGATCACGGCTGACGTACTGGACAT
>probe:Drosophila_2:1633378_at:247:585; Interrogation_Position=352; Antisense; TGGCAGCCACAGATGGTTCACCAAT
>probe:Drosophila_2:1633378_at:125:711; Interrogation_Position=368; Antisense; TTCACCAATGCCCAGCGAATTAGTT
>probe:Drosophila_2:1633378_at:318:295; Interrogation_Position=383; Antisense; CGAATTAGTTCGCTCAGGTGGGCAA
>probe:Drosophila_2:1633378_at:626:143; Interrogation_Position=441; Antisense; ACTGCATCCACCTTGGCTATATTTA
>probe:Drosophila_2:1633378_at:79:339; Interrogation_Position=487; Antisense; GCTAAACGATAGACCCTGCTCACAG
>probe:Drosophila_2:1633378_at:607:707; Interrogation_Position=592; Antisense; TTCACAAACCTCTTCCATTTCAGAA
>probe:Drosophila_2:1633378_at:547:241; Interrogation_Position=656; Antisense; AATACTATTTTCTTGAGCAGCCATA
>probe:Drosophila_2:1633378_at:555:491; Interrogation_Position=731; Antisense; GTAAACTTATCTCGCACTTCTGCAA

Paste this into a BLAST search page for me
ACTTCTTTGGCACGGAGTCCTTGAAGTCCTTGAACTGGTACGAGGCCTACGAAATGCCGCGAATTGAACTCTGAGGAACTCTGAGCTGGTCACATTCGAAGACCAGGAGTTCGATGCCGTTACGGGGATCACGGCTGACGTACTGGACATTGGCAGCCACAGATGGTTCACCAATTTCACCAATGCCCAGCGAATTAGTTCGAATTAGTTCGCTCAGGTGGGCAAACTGCATCCACCTTGGCTATATTTAGCTAAACGATAGACCCTGCTCACAGTTCACAAACCTCTTCCATTTCAGAAAATACTATTTTCTTGAGCAGCCATAGTAAACTTATCTCGCACTTCTGCAA

Full Affymetrix probeset data:

Annotations for 1633378_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime