Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633380_at:

>probe:Drosophila_2:1633380_at:353:53; Interrogation_Position=1031; Antisense; ATGCTCATTGTATTTGGCGGACTGC
>probe:Drosophila_2:1633380_at:225:39; Interrogation_Position=1066; Antisense; ATCTGCCTTGGCCAACGACGAGAAA
>probe:Drosophila_2:1633380_at:716:291; Interrogation_Position=1096; Antisense; CGTAGATGATCCTGAGCTGCTGTTC
>probe:Drosophila_2:1633380_at:653:335; Interrogation_Position=1111; Antisense; GCTGCTGTTCGACCACTATGTAAAT
>probe:Drosophila_2:1633380_at:197:11; Interrogation_Position=1163; Antisense; ATTCGCACCGAGGAAGCGCTGTTGA
>probe:Drosophila_2:1633380_at:495:617; Interrogation_Position=1189; Antisense; TGCTTTAGCGGCTCTCCAGGAGAAA
>probe:Drosophila_2:1633380_at:298:195; Interrogation_Position=1212; Antisense; AACTGCAACCGCAAGTGGCTGATGT
>probe:Drosophila_2:1633380_at:697:291; Interrogation_Position=1243; Antisense; CGATTTGACTGATCTGCTACCTAAA
>probe:Drosophila_2:1633380_at:295:713; Interrogation_Position=1276; Antisense; TTCAGGCATTGCAGTACGGCGAGAT
>probe:Drosophila_2:1633380_at:173:389; Interrogation_Position=1355; Antisense; GAAACAGTCGTTGATGAACCTTCAT
>probe:Drosophila_2:1633380_at:631:393; Interrogation_Position=1396; Antisense; GAAAGTGGCTCGACTGACGGCCAAT
>probe:Drosophila_2:1633380_at:511:179; Interrogation_Position=1453; Antisense; AAACACCCCAGCACAAGACGATTTT
>probe:Drosophila_2:1633380_at:653:709; Interrogation_Position=1476; Antisense; TTGAAGTGGTTTCATCCACCACCGT
>probe:Drosophila_2:1633380_at:455:585; Interrogation_Position=1504; Antisense; TGGAACAAGCCACTCGTGTGCAGAT

Paste this into a BLAST search page for me
ATGCTCATTGTATTTGGCGGACTGCATCTGCCTTGGCCAACGACGAGAAACGTAGATGATCCTGAGCTGCTGTTCGCTGCTGTTCGACCACTATGTAAATATTCGCACCGAGGAAGCGCTGTTGATGCTTTAGCGGCTCTCCAGGAGAAAAACTGCAACCGCAAGTGGCTGATGTCGATTTGACTGATCTGCTACCTAAATTCAGGCATTGCAGTACGGCGAGATGAAACAGTCGTTGATGAACCTTCATGAAAGTGGCTCGACTGACGGCCAATAAACACCCCAGCACAAGACGATTTTTTGAAGTGGTTTCATCCACCACCGTTGGAACAAGCCACTCGTGTGCAGAT

Full Affymetrix probeset data:

Annotations for 1633380_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime