FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633381_at:

>probe:Drosophila_2:1633381_at:346:115; Interrogation_Position=1224; Antisense; AGCAGATGCAGCGATTCCTTGACAC
>probe:Drosophila_2:1633381_at:7:463; Interrogation_Position=1236; Antisense; GATTCCTTGACACCTTCGAGGATGT
>probe:Drosophila_2:1633381_at:267:89; Interrogation_Position=1276; Antisense; AGTCATTACGCTGGTGCTGGAGGAT
>probe:Drosophila_2:1633381_at:96:545; Interrogation_Position=1297; Antisense; GGATCCGGCCGGTAATACCTATGTG
>probe:Drosophila_2:1633381_at:287:509; Interrogation_Position=1319; Antisense; GTGCAATCACTGAGCGATGACGACT
>probe:Drosophila_2:1633381_at:213:445; Interrogation_Position=1334; Antisense; GATGACGACTCGGAGCCGGATGACA
>probe:Drosophila_2:1633381_at:7:319; Interrogation_Position=1348; Antisense; GCCGGATGACAAGCTCACTGTGGAG
>probe:Drosophila_2:1633381_at:79:539; Interrogation_Position=1374; Antisense; GGTACGATCGCTCCTACGAGGACAA
>probe:Drosophila_2:1633381_at:112:545; Interrogation_Position=1402; Antisense; GGATCTGGGCCTCAATGACATGAAG
>probe:Drosophila_2:1633381_at:382:573; Interrogation_Position=1447; Antisense; GGCGTGATGAAGTCTGCATTCGCAA
>probe:Drosophila_2:1633381_at:557:455; Interrogation_Position=1582; Antisense; GATAGGGTCAGATCGGCTCGGCTAT
>probe:Drosophila_2:1633381_at:668:545; Interrogation_Position=1635; Antisense; GGATGGTCGGAAACTCTTCCTATTG
>probe:Drosophila_2:1633381_at:200:307; Interrogation_Position=1653; Antisense; CCTATTGCCTGTTCTTTTACTTCTA
>probe:Drosophila_2:1633381_at:652:363; Interrogation_Position=1681; Antisense; GAATCTAGTCTACACTTTTACTCGA

Paste this into a BLAST search page for me
AGCAGATGCAGCGATTCCTTGACACGATTCCTTGACACCTTCGAGGATGTAGTCATTACGCTGGTGCTGGAGGATGGATCCGGCCGGTAATACCTATGTGGTGCAATCACTGAGCGATGACGACTGATGACGACTCGGAGCCGGATGACAGCCGGATGACAAGCTCACTGTGGAGGGTACGATCGCTCCTACGAGGACAAGGATCTGGGCCTCAATGACATGAAGGGCGTGATGAAGTCTGCATTCGCAAGATAGGGTCAGATCGGCTCGGCTATGGATGGTCGGAAACTCTTCCTATTGCCTATTGCCTGTTCTTTTACTTCTAGAATCTAGTCTACACTTTTACTCGA

Full Affymetrix probeset data:

Annotations for 1633381_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720