FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633383_at:

>probe:Drosophila_2:1633383_at:119:109; Interrogation_Position=1830; Antisense; AGAAGCAGCCATATCCGTACAGCAC
>probe:Drosophila_2:1633383_at:38:267; Interrogation_Position=1891; Antisense; CAGTCAACCGTGCAACACCATCAAT
>probe:Drosophila_2:1633383_at:327:271; Interrogation_Position=1909; Antisense; CATCAATCCCGGCAGCAAAATGAGC
>probe:Drosophila_2:1633383_at:30:123; Interrogation_Position=1946; Antisense; AGCGTCAGCAGCAACCAGCACATGG
>probe:Drosophila_2:1633383_at:476:257; Interrogation_Position=2007; Antisense; CAGCATCAGCTCCATTATCAATGGG
>probe:Drosophila_2:1633383_at:537:511; Interrogation_Position=2034; Antisense; GTGAGAACAGTGCATTTCGCGCTCT
>probe:Drosophila_2:1633383_at:31:635; Interrogation_Position=2124; Antisense; TCGCCCGCCAGTACATAGCCAAGTA
>probe:Drosophila_2:1633383_at:158:27; Interrogation_Position=2138; Antisense; ATAGCCAAGTACATGGGCACGCCCC
>probe:Drosophila_2:1633383_at:712:133; Interrogation_Position=2156; Antisense; ACGCCCCTCAATCTGGGACATGGTT
>probe:Drosophila_2:1633383_at:456:557; Interrogation_Position=2171; Antisense; GGACATGGTTCGTCACCAATCCAGG
>probe:Drosophila_2:1633383_at:637:87; Interrogation_Position=2199; Antisense; AGTCTGGACGGGATCATCAGTCGGA
>probe:Drosophila_2:1633383_at:662:229; Interrogation_Position=2267; Antisense; AATGTGGAGCACGACGCCGAGTGAC
>probe:Drosophila_2:1633383_at:402:609; Interrogation_Position=2288; Antisense; TGACCATTTCATTCCTATCGCTTTA
>probe:Drosophila_2:1633383_at:337:159; Interrogation_Position=2367; Antisense; ACAAAACTTCTAACCGCGTGCTGAG

Paste this into a BLAST search page for me
AGAAGCAGCCATATCCGTACAGCACCAGTCAACCGTGCAACACCATCAATCATCAATCCCGGCAGCAAAATGAGCAGCGTCAGCAGCAACCAGCACATGGCAGCATCAGCTCCATTATCAATGGGGTGAGAACAGTGCATTTCGCGCTCTTCGCCCGCCAGTACATAGCCAAGTAATAGCCAAGTACATGGGCACGCCCCACGCCCCTCAATCTGGGACATGGTTGGACATGGTTCGTCACCAATCCAGGAGTCTGGACGGGATCATCAGTCGGAAATGTGGAGCACGACGCCGAGTGACTGACCATTTCATTCCTATCGCTTTAACAAAACTTCTAACCGCGTGCTGAG

Full Affymetrix probeset data:

Annotations for 1633383_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720