FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633384_at:

>probe:Drosophila_2:1633384_at:516:109; Interrogation_Position=243; Antisense; AGAAGATGCTCAATTCCACCTCGAA
>probe:Drosophila_2:1633384_at:601:23; Interrogation_Position=293; Antisense; ATATGCGCCGGCCTGATAGACGGAC
>probe:Drosophila_2:1633384_at:668:367; Interrogation_Position=337; Antisense; GAATCCGGAGCTAGAACTTCTCATG
>probe:Drosophila_2:1633384_at:142:353; Interrogation_Position=403; Antisense; GCAGCCCAAGGAGGTATCCGACCAA
>probe:Drosophila_2:1633384_at:398:141; Interrogation_Position=464; Antisense; ACGGTCTCCGGCAGCATGAGCAAGA
>probe:Drosophila_2:1633384_at:57:455; Interrogation_Position=533; Antisense; GATAGTGATAGTCCGCATGCCATGA
>probe:Drosophila_2:1633384_at:503:179; Interrogation_Position=572; Antisense; AAGAAACCACGCTCGGGTGACGAAT
>probe:Drosophila_2:1633384_at:387:475; Interrogation_Position=613; Antisense; GTTACACTCGTGACTTAGCTTTTAG
>probe:Drosophila_2:1633384_at:26:365; Interrogation_Position=652; Antisense; GAATTCAATTGTACTCGCGCTGTGC
>probe:Drosophila_2:1633384_at:400:359; Interrogation_Position=691; Antisense; GCAAGGCGTAGCACATCTGGTTGTT
>probe:Drosophila_2:1633384_at:586:641; Interrogation_Position=706; Antisense; TCTGGTTGTTGTTGATCCATCGCCA
>probe:Drosophila_2:1633384_at:509:45; Interrogation_Position=724; Antisense; ATCGCCAGGTGTTGCTCCAAAAGTC
>probe:Drosophila_2:1633384_at:588:85; Interrogation_Position=745; Antisense; AGTCGTAGGTGCTTCCATTTACCAA
>probe:Drosophila_2:1633384_at:144:187; Interrogation_Position=768; Antisense; AACACCGTCTGACAGTTCACTGCAG

Paste this into a BLAST search page for me
AGAAGATGCTCAATTCCACCTCGAAATATGCGCCGGCCTGATAGACGGACGAATCCGGAGCTAGAACTTCTCATGGCAGCCCAAGGAGGTATCCGACCAAACGGTCTCCGGCAGCATGAGCAAGAGATAGTGATAGTCCGCATGCCATGAAAGAAACCACGCTCGGGTGACGAATGTTACACTCGTGACTTAGCTTTTAGGAATTCAATTGTACTCGCGCTGTGCGCAAGGCGTAGCACATCTGGTTGTTTCTGGTTGTTGTTGATCCATCGCCAATCGCCAGGTGTTGCTCCAAAAGTCAGTCGTAGGTGCTTCCATTTACCAAAACACCGTCTGACAGTTCACTGCAG

Full Affymetrix probeset data:

Annotations for 1633384_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720