Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633385_at:

>probe:Drosophila_2:1633385_at:725:237; Interrogation_Position=1157; Antisense; AATAAACGGTAATATAGCGCAGAAT
>probe:Drosophila_2:1633385_at:339:159; Interrogation_Position=1185; Antisense; ACAAAACAATCGTACGCCCTGAGCG
>probe:Drosophila_2:1633385_at:564:671; Interrogation_Position=1197; Antisense; TACGCCCTGAGCGAGTTGAAGCGAT
>probe:Drosophila_2:1633385_at:527:723; Interrogation_Position=1212; Antisense; TTGAAGCGATAAGGCCTTGCTCTCG
>probe:Drosophila_2:1633385_at:510:453; Interrogation_Position=1219; Antisense; GATAAGGCCTTGCTCTCGCTTTTTC
>probe:Drosophila_2:1633385_at:246:635; Interrogation_Position=1234; Antisense; TCGCTTTTTCGCTTAAGCTCGCAAC
>probe:Drosophila_2:1633385_at:509:709; Interrogation_Position=1246; Antisense; TTAAGCTCGCAACTCGCTTCGCTCT
>probe:Drosophila_2:1633385_at:343:643; Interrogation_Position=1268; Antisense; TCTCACTCTGACATCTTTCGAGCGA
>probe:Drosophila_2:1633385_at:408:611; Interrogation_Position=1276; Antisense; TGACATCTTTCGAGCGATTGCGCTT
>probe:Drosophila_2:1633385_at:537:417; Interrogation_Position=1287; Antisense; GAGCGATTGCGCTTAAAATGCATGC
>probe:Drosophila_2:1633385_at:599:163; Interrogation_Position=1302; Antisense; AAATGCATGCAGTGGGTTTATCGCT
>probe:Drosophila_2:1633385_at:572:269; Interrogation_Position=1307; Antisense; CATGCAGTGGGTTTATCGCTCGTTC
>probe:Drosophila_2:1633385_at:149:541; Interrogation_Position=1316; Antisense; GGTTTATCGCTCGTTCTTGTATTAT
>probe:Drosophila_2:1633385_at:457:337; Interrogation_Position=1324; Antisense; GCTCGTTCTTGTATTATTAGTCTAA

Paste this into a BLAST search page for me
AATAAACGGTAATATAGCGCAGAATACAAAACAATCGTACGCCCTGAGCGTACGCCCTGAGCGAGTTGAAGCGATTTGAAGCGATAAGGCCTTGCTCTCGGATAAGGCCTTGCTCTCGCTTTTTCTCGCTTTTTCGCTTAAGCTCGCAACTTAAGCTCGCAACTCGCTTCGCTCTTCTCACTCTGACATCTTTCGAGCGATGACATCTTTCGAGCGATTGCGCTTGAGCGATTGCGCTTAAAATGCATGCAAATGCATGCAGTGGGTTTATCGCTCATGCAGTGGGTTTATCGCTCGTTCGGTTTATCGCTCGTTCTTGTATTATGCTCGTTCTTGTATTATTAGTCTAA

Full Affymetrix probeset data:

Annotations for 1633385_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime