Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633386_s_at:

>probe:Drosophila_2:1633386_s_at:544:261; Interrogation_Position=116; Antisense; CAGCCTGTTGCGGAAGTTTATCTAC
>probe:Drosophila_2:1633386_s_at:209:477; Interrogation_Position=131; Antisense; GTTTATCTACTTGGTGTTCAGCCCC
>probe:Drosophila_2:1633386_s_at:310:659; Interrogation_Position=158; Antisense; TAACTTTTACCGCATGGCACCCTTG
>probe:Drosophila_2:1633386_s_at:272:259; Interrogation_Position=175; Antisense; CACCCTTGACGACCTTGTTGTGGAA
>probe:Drosophila_2:1633386_s_at:350:599; Interrogation_Position=332; Antisense; TGAAACCCGTTAAAATCCGCTTGCG
>probe:Drosophila_2:1633386_s_at:362:357; Interrogation_Position=360; Antisense; GCAACTTGGCCCGACTAAGGCAAAA
>probe:Drosophila_2:1633386_s_at:411:351; Interrogation_Position=409; Antisense; GCAGACAGGGCGATTTACATTATAA
>probe:Drosophila_2:1633386_s_at:279:543; Interrogation_Position=448; Antisense; GGATTAGTCATCATCAGTACCTGCT
>probe:Drosophila_2:1633386_s_at:310:487; Interrogation_Position=464; Antisense; GTACCTGCTTATCTGGTTTTCCTGA
>probe:Drosophila_2:1633386_s_at:407:39; Interrogation_Position=501; Antisense; ATCTGTGACTGTATCTCTTACCTTT
>probe:Drosophila_2:1633386_s_at:56:693; Interrogation_Position=523; Antisense; TTTCCTCTTGTACCTCGTTATTATA
>probe:Drosophila_2:1633386_s_at:390:185; Interrogation_Position=547; Antisense; AAAATGCGAAAACCCTCTGCCAAAG
>probe:Drosophila_2:1633386_s_at:660:447; Interrogation_Position=59; Antisense; GATCCCAATGTTGTGGCCTTTGTGC
>probe:Drosophila_2:1633386_s_at:10:117; Interrogation_Position=86; Antisense; AGCTTTGACGCACAGAAATCCTCTC

Paste this into a BLAST search page for me
CAGCCTGTTGCGGAAGTTTATCTACGTTTATCTACTTGGTGTTCAGCCCCTAACTTTTACCGCATGGCACCCTTGCACCCTTGACGACCTTGTTGTGGAATGAAACCCGTTAAAATCCGCTTGCGGCAACTTGGCCCGACTAAGGCAAAAGCAGACAGGGCGATTTACATTATAAGGATTAGTCATCATCAGTACCTGCTGTACCTGCTTATCTGGTTTTCCTGAATCTGTGACTGTATCTCTTACCTTTTTTCCTCTTGTACCTCGTTATTATAAAAATGCGAAAACCCTCTGCCAAAGGATCCCAATGTTGTGGCCTTTGTGCAGCTTTGACGCACAGAAATCCTCTC

Full Affymetrix probeset data:

Annotations for 1633386_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime