FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633387_at:

>probe:Drosophila_2:1633387_at:496:195; Interrogation_Position=3363; Antisense; AACTGGTTTGATTACAGCTCTTCAG
>probe:Drosophila_2:1633387_at:396:117; Interrogation_Position=3378; Antisense; AGCTCTTCAGCTTCAATTACCGATT
>probe:Drosophila_2:1633387_at:176:13; Interrogation_Position=3393; Antisense; ATTACCGATTCTAGATCTCAAGATC
>probe:Drosophila_2:1633387_at:349:623; Interrogation_Position=3408; Antisense; TCTCAAGATCGATCAGTCTAGTGAC
>probe:Drosophila_2:1633387_at:66:13; Interrogation_Position=3445; Antisense; ATTAATGAACTTTTCCGCTGGGCCA
>probe:Drosophila_2:1633387_at:76:523; Interrogation_Position=3464; Antisense; GGGCCAGGAGTTTTCAACGCTTTAT
>probe:Drosophila_2:1633387_at:374:245; Interrogation_Position=3496; Antisense; AATTCTTATTTCTTACCGCTTGGCA
>probe:Drosophila_2:1633387_at:585:705; Interrogation_Position=3508; Antisense; TTACCGCTTGGCATTTACTGGAAAT
>probe:Drosophila_2:1633387_at:221:671; Interrogation_Position=3523; Antisense; TACTGGAAATTTACTGTGCTGGCAC
>probe:Drosophila_2:1633387_at:508:507; Interrogation_Position=3538; Antisense; GTGCTGGCACATCAATCAAGTCTCT
>probe:Drosophila_2:1633387_at:598:327; Interrogation_Position=3620; Antisense; GCGTTGATTCGTTGATTGATTTGCA
>probe:Drosophila_2:1633387_at:639:315; Interrogation_Position=3725; Antisense; GCCTAAGTTGTTGTACATACGCTAT
>probe:Drosophila_2:1633387_at:45:695; Interrogation_Position=3759; Antisense; TTTGCTGTACATAATCCCGAGTGCC
>probe:Drosophila_2:1633387_at:209:433; Interrogation_Position=3777; Antisense; GAGTGCCCTCAAATCCGAGAACCAC

Paste this into a BLAST search page for me
AACTGGTTTGATTACAGCTCTTCAGAGCTCTTCAGCTTCAATTACCGATTATTACCGATTCTAGATCTCAAGATCTCTCAAGATCGATCAGTCTAGTGACATTAATGAACTTTTCCGCTGGGCCAGGGCCAGGAGTTTTCAACGCTTTATAATTCTTATTTCTTACCGCTTGGCATTACCGCTTGGCATTTACTGGAAATTACTGGAAATTTACTGTGCTGGCACGTGCTGGCACATCAATCAAGTCTCTGCGTTGATTCGTTGATTGATTTGCAGCCTAAGTTGTTGTACATACGCTATTTTGCTGTACATAATCCCGAGTGCCGAGTGCCCTCAAATCCGAGAACCAC

Full Affymetrix probeset data:

Annotations for 1633387_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720