FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633389_at:

>probe:Drosophila_2:1633389_at:297:119; Interrogation_Position=1142; Antisense; AGCTGCGCGTTTACTCAATACTTTT
>probe:Drosophila_2:1633389_at:630:439; Interrogation_Position=627; Antisense; GATGGTCAGTCGGTCGCAGGTTACC
>probe:Drosophila_2:1633389_at:81:75; Interrogation_Position=644; Antisense; AGGTTACCTTCGGAGCAGTGGCCTC
>probe:Drosophila_2:1633389_at:700:507; Interrogation_Position=700; Antisense; GTGCTGTCGGGCATCAACATTTTAA
>probe:Drosophila_2:1633389_at:111:699; Interrogation_Position=720; Antisense; TTTAATCACCATTCAGGGCACACTC
>probe:Drosophila_2:1633389_at:50:567; Interrogation_Position=736; Antisense; GGCACACTCGGCCTAATTGTGAGCG
>probe:Drosophila_2:1633389_at:568:3; Interrogation_Position=751; Antisense; ATTGTGAGCGGCATCTCCATATTCT
>probe:Drosophila_2:1633389_at:86:629; Interrogation_Position=766; Antisense; TCCATATTCTGGTGCGCCATATCGG
>probe:Drosophila_2:1633389_at:451:21; Interrogation_Position=784; Antisense; ATATCGGCCTCGAAACTGTTCGCCA
>probe:Drosophila_2:1633389_at:723:185; Interrogation_Position=830; Antisense; AACAGCTGCTGATTGCCTATCCGTG
>probe:Drosophila_2:1633389_at:68:549; Interrogation_Position=868; Antisense; GGAGGATTTGCGTTGATTACCATTT
>probe:Drosophila_2:1633389_at:630:147; Interrogation_Position=936; Antisense; ACTACGCCCTCTGTTGTTGTGTTTG
>probe:Drosophila_2:1633389_at:671:479; Interrogation_Position=956; Antisense; GTTTGCCTGGTTTTAATTGTCCTGC
>probe:Drosophila_2:1633389_at:157:5; Interrogation_Position=971; Antisense; ATTGTCCTGCAAACACACACTCTAG

Paste this into a BLAST search page for me
AGCTGCGCGTTTACTCAATACTTTTGATGGTCAGTCGGTCGCAGGTTACCAGGTTACCTTCGGAGCAGTGGCCTCGTGCTGTCGGGCATCAACATTTTAATTTAATCACCATTCAGGGCACACTCGGCACACTCGGCCTAATTGTGAGCGATTGTGAGCGGCATCTCCATATTCTTCCATATTCTGGTGCGCCATATCGGATATCGGCCTCGAAACTGTTCGCCAAACAGCTGCTGATTGCCTATCCGTGGGAGGATTTGCGTTGATTACCATTTACTACGCCCTCTGTTGTTGTGTTTGGTTTGCCTGGTTTTAATTGTCCTGCATTGTCCTGCAAACACACACTCTAG

Full Affymetrix probeset data:

Annotations for 1633389_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720