Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633390_at:

>probe:Drosophila_2:1633390_at:409:365; Interrogation_Position=7561; Antisense; GAATATCTCCGGTGTCATCGGTGGC
>probe:Drosophila_2:1633390_at:305:431; Interrogation_Position=7594; Antisense; GATGATAGGCGGCAAGTCGTTACTA
>probe:Drosophila_2:1633390_at:688:87; Interrogation_Position=7608; Antisense; AGTCGTTACTAAACGCCATTGGCAA
>probe:Drosophila_2:1633390_at:603:709; Interrogation_Position=7654; Antisense; TTCAAAATTTCGATCACCTCCACCA
>probe:Drosophila_2:1633390_at:90:233; Interrogation_Position=7712; Antisense; AATGAAAGTCCCATCCTGATTACCT
>probe:Drosophila_2:1633390_at:431:307; Interrogation_Position=7741; Antisense; CCAGCATCATTTTGAGCCTGAGAGA
>probe:Drosophila_2:1633390_at:207:205; Interrogation_Position=7779; Antisense; AAGCGCAACGCTTTTGTAAACTACA
>probe:Drosophila_2:1633390_at:324:105; Interrogation_Position=7960; Antisense; AGACTTCCTTATACTTCAGACCTAG
>probe:Drosophila_2:1633390_at:650:413; Interrogation_Position=7978; Antisense; GACCTAGCATTCAACCTAAGCACTG
>probe:Drosophila_2:1633390_at:491:143; Interrogation_Position=7999; Antisense; ACTGAGTCCCCACATTGGCAAAATA
>probe:Drosophila_2:1633390_at:225:567; Interrogation_Position=8015; Antisense; GGCAAAATACTTTCCTCGATCTTAA
>probe:Drosophila_2:1633390_at:455:453; Interrogation_Position=8032; Antisense; GATCTTAATATGGTCGCGCGTTGAA
>probe:Drosophila_2:1633390_at:597:535; Interrogation_Position=8043; Antisense; GGTCGCGCGTTGAAACGTCACATAA
>probe:Drosophila_2:1633390_at:504:591; Interrogation_Position=8117; Antisense; TGTAACTTTAGGTTCGCGTATTTAG

Paste this into a BLAST search page for me
GAATATCTCCGGTGTCATCGGTGGCGATGATAGGCGGCAAGTCGTTACTAAGTCGTTACTAAACGCCATTGGCAATTCAAAATTTCGATCACCTCCACCAAATGAAAGTCCCATCCTGATTACCTCCAGCATCATTTTGAGCCTGAGAGAAAGCGCAACGCTTTTGTAAACTACAAGACTTCCTTATACTTCAGACCTAGGACCTAGCATTCAACCTAAGCACTGACTGAGTCCCCACATTGGCAAAATAGGCAAAATACTTTCCTCGATCTTAAGATCTTAATATGGTCGCGCGTTGAAGGTCGCGCGTTGAAACGTCACATAATGTAACTTTAGGTTCGCGTATTTAG

Full Affymetrix probeset data:

Annotations for 1633390_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime