FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633391_at:

>probe:Drosophila_2:1633391_at:190:145; Interrogation_Position=1815; Antisense; ACTCCGGTGGTGTCGTCTGGCACAA
>probe:Drosophila_2:1633391_at:576:45; Interrogation_Position=1857; Antisense; ATGCCGATATTTTGGCCTTCGATAT
>probe:Drosophila_2:1633391_at:338:499; Interrogation_Position=1902; Antisense; GTCTGCTGCCATATTATCGGTACTT
>probe:Drosophila_2:1633391_at:357:367; Interrogation_Position=1928; Antisense; GAATCGTGTGTGTTGTCCAGACCCG
>probe:Drosophila_2:1633391_at:70:419; Interrogation_Position=1973; Antisense; GAGCATTTCATTCCCAGTGATGTCT
>probe:Drosophila_2:1633391_at:24:267; Interrogation_Position=2023; Antisense; CAGTTGGGCTGATGTGGACCTCATT
>probe:Drosophila_2:1633391_at:217:235; Interrogation_Position=2066; Antisense; AATCCTGTTCATGGATCCATTGGCC
>probe:Drosophila_2:1633391_at:579:721; Interrogation_Position=2085; Antisense; TTGGCCCCACCTTCAGTTGCATTAT
>probe:Drosophila_2:1633391_at:497:39; Interrogation_Position=2108; Antisense; ATCTCTGAGCAATTCGTACATGTTC
>probe:Drosophila_2:1633391_at:569:421; Interrogation_Position=2180; Antisense; GAGCAATATCGCCACTTCAATGGAA
>probe:Drosophila_2:1633391_at:146:563; Interrogation_Position=2201; Antisense; GGAACCAAACTCCTTTGCCTGAATT
>probe:Drosophila_2:1633391_at:669:275; Interrogation_Position=2231; Antisense; CTTTCAGCTGTTCCCCAGAATATCT
>probe:Drosophila_2:1633391_at:378:107; Interrogation_Position=2247; Antisense; AGAATATCTTCCAGTTGCCATCGGC
>probe:Drosophila_2:1633391_at:442:179; Interrogation_Position=2315; Antisense; AAACAACGCTGCTCACATTTAAGAT

Paste this into a BLAST search page for me
ACTCCGGTGGTGTCGTCTGGCACAAATGCCGATATTTTGGCCTTCGATATGTCTGCTGCCATATTATCGGTACTTGAATCGTGTGTGTTGTCCAGACCCGGAGCATTTCATTCCCAGTGATGTCTCAGTTGGGCTGATGTGGACCTCATTAATCCTGTTCATGGATCCATTGGCCTTGGCCCCACCTTCAGTTGCATTATATCTCTGAGCAATTCGTACATGTTCGAGCAATATCGCCACTTCAATGGAAGGAACCAAACTCCTTTGCCTGAATTCTTTCAGCTGTTCCCCAGAATATCTAGAATATCTTCCAGTTGCCATCGGCAAACAACGCTGCTCACATTTAAGAT

Full Affymetrix probeset data:

Annotations for 1633391_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720