FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633392_at:

>probe:Drosophila_2:1633392_at:271:119; Interrogation_Position=122; Antisense; AGCTGGGTCGGGATTCACGATGTCC
>probe:Drosophila_2:1633392_at:57:543; Interrogation_Position=132; Antisense; GGATTCACGATGTCCACTCTGCAGA
>probe:Drosophila_2:1633392_at:28:617; Interrogation_Position=151; Antisense; TGCAGACGCGACTTCAGGGCGGACA
>probe:Drosophila_2:1633392_at:67:127; Interrogation_Position=179; Antisense; AGCCTTCTCTGTCCAATAATTCTGC
>probe:Drosophila_2:1633392_at:475:437; Interrogation_Position=205; Antisense; GAGGAAGTCGAGTCCTTGCCCGGAA
>probe:Drosophila_2:1633392_at:630:85; Interrogation_Position=215; Antisense; AGTCCTTGCCCGGAACTGAAATGGA
>probe:Drosophila_2:1633392_at:133:395; Interrogation_Position=232; Antisense; GAAATGGACACGCTTGTGCTGACCC
>probe:Drosophila_2:1633392_at:506:507; Interrogation_Position=247; Antisense; GTGCTGACCCTTTCAGAACAGGAGT
>probe:Drosophila_2:1633392_at:228:189; Interrogation_Position=263; Antisense; AACAGGAGTGCTGGTTCTTTGAACA
>probe:Drosophila_2:1633392_at:375:713; Interrogation_Position=277; Antisense; TTCTTTGAACAGCTCTACCGGGATG
>probe:Drosophila_2:1633392_at:39:529; Interrogation_Position=32; Antisense; GGGACCAGGATAGCCAATATGAACA
>probe:Drosophila_2:1633392_at:466:613; Interrogation_Position=51; Antisense; TGAACAGAGATATCCGCACCACATA
>probe:Drosophila_2:1633392_at:658:149; Interrogation_Position=71; Antisense; ACATATCCTGCGGTCATTCCTTCTG
>probe:Drosophila_2:1633392_at:331:7; Interrogation_Position=86; Antisense; ATTCCTTCTGCTCGGCGTGCTTAAA

Paste this into a BLAST search page for me
AGCTGGGTCGGGATTCACGATGTCCGGATTCACGATGTCCACTCTGCAGATGCAGACGCGACTTCAGGGCGGACAAGCCTTCTCTGTCCAATAATTCTGCGAGGAAGTCGAGTCCTTGCCCGGAAAGTCCTTGCCCGGAACTGAAATGGAGAAATGGACACGCTTGTGCTGACCCGTGCTGACCCTTTCAGAACAGGAGTAACAGGAGTGCTGGTTCTTTGAACATTCTTTGAACAGCTCTACCGGGATGGGGACCAGGATAGCCAATATGAACATGAACAGAGATATCCGCACCACATAACATATCCTGCGGTCATTCCTTCTGATTCCTTCTGCTCGGCGTGCTTAAA

Full Affymetrix probeset data:

Annotations for 1633392_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720