FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633393_at:

>probe:Drosophila_2:1633393_at:340:309; Interrogation_Position=1376; Antisense; CCAACGGACGCAGTGGTTTGTTCAA
>probe:Drosophila_2:1633393_at:108:275; Interrogation_Position=1475; Antisense; CATTCCTGCTGCTGTATGTGATCAA
>probe:Drosophila_2:1633393_at:589:15; Interrogation_Position=1504; Antisense; ATTATACCCATTCGCATGGATCCAC
>probe:Drosophila_2:1633393_at:95:279; Interrogation_Position=1552; Antisense; CTAACGGAGCATCGGATTCGGCACT
>probe:Drosophila_2:1633393_at:562:9; Interrogation_Position=1567; Antisense; ATTCGGCACTCACAAATCGGTTTAT
>probe:Drosophila_2:1633393_at:656:165; Interrogation_Position=1580; Antisense; AAATCGGTTTATCGCGAGCCATCTC
>probe:Drosophila_2:1633393_at:117:41; Interrogation_Position=1628; Antisense; ATCTGAAAGATATCGCCGGCATCCA
>probe:Drosophila_2:1633393_at:605:47; Interrogation_Position=1667; Antisense; ATCCTGGCCACGAGCGGAGCATAGA
>probe:Drosophila_2:1633393_at:401:83; Interrogation_Position=1724; Antisense; AGTGGCAATCCTACCTGGAGCAGGT
>probe:Drosophila_2:1633393_at:189:401; Interrogation_Position=1798; Antisense; GACATCAACTTCAAGCCCAGGACGG
>probe:Drosophila_2:1633393_at:314:685; Interrogation_Position=1845; Antisense; TATCCCTGCCCGGAAGAGCATAAGT
>probe:Drosophila_2:1633393_at:311:519; Interrogation_Position=1868; Antisense; GTGGTGGCCTGTACAGATCCAACAA
>probe:Drosophila_2:1633393_at:680:339; Interrogation_Position=1899; Antisense; GCTACCGGTGATAGGCTCTGTGATG
>probe:Drosophila_2:1633393_at:269:161; Interrogation_Position=1938; Antisense; AAAGGATCCCAACTTTGCCTGGGTG

Paste this into a BLAST search page for me
CCAACGGACGCAGTGGTTTGTTCAACATTCCTGCTGCTGTATGTGATCAAATTATACCCATTCGCATGGATCCACCTAACGGAGCATCGGATTCGGCACTATTCGGCACTCACAAATCGGTTTATAAATCGGTTTATCGCGAGCCATCTCATCTGAAAGATATCGCCGGCATCCAATCCTGGCCACGAGCGGAGCATAGAAGTGGCAATCCTACCTGGAGCAGGTGACATCAACTTCAAGCCCAGGACGGTATCCCTGCCCGGAAGAGCATAAGTGTGGTGGCCTGTACAGATCCAACAAGCTACCGGTGATAGGCTCTGTGATGAAAGGATCCCAACTTTGCCTGGGTG

Full Affymetrix probeset data:

Annotations for 1633393_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720