FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633396_at:

>probe:Drosophila_2:1633396_at:271:47; Interrogation_Position=2378; Antisense; ATCCGCACCATCACAATGCGTGGGC
>probe:Drosophila_2:1633396_at:68:35; Interrogation_Position=2387; Antisense; ATCACAATGCGTGGGCAGCGGCCTA
>probe:Drosophila_2:1633396_at:127:595; Interrogation_Position=2398; Antisense; TGGGCAGCGGCCTATCATCCACATG
>probe:Drosophila_2:1633396_at:163:49; Interrogation_Position=2414; Antisense; ATCCACATGCCACCGCCTAGGATGT
>probe:Drosophila_2:1633396_at:255:447; Interrogation_Position=2443; Antisense; GATCCTTCCCAAAATTGTTACAGTT
>probe:Drosophila_2:1633396_at:132:233; Interrogation_Position=2484; Antisense; AATGCCATAATGTCCCAAAACCCAG
>probe:Drosophila_2:1633396_at:408:653; Interrogation_Position=2491; Antisense; TAATGTCCCAAAACCCAGAACGGCA
>probe:Drosophila_2:1633396_at:675:381; Interrogation_Position=2508; Antisense; GAACGGCAACAAAGCAAGCGTAGAA
>probe:Drosophila_2:1633396_at:145:303; Interrogation_Position=2734; Antisense; CCCCAATCTAGTAGCTAAGGCATTT
>probe:Drosophila_2:1633396_at:593:687; Interrogation_Position=2762; Antisense; TTTGCATGTCTGTACATACAAACAT
>probe:Drosophila_2:1633396_at:616:673; Interrogation_Position=2790; Antisense; TAGCGTTCTTTTTAAGCCATACCAT
>probe:Drosophila_2:1633396_at:483:391; Interrogation_Position=2826; Antisense; GAAACCATCTAGTTGTGTACCATAA
>probe:Drosophila_2:1633396_at:45:223; Interrogation_Position=2907; Antisense; AAGGCGACAAAATCCCCACACTGAA
>probe:Drosophila_2:1633396_at:456:45; Interrogation_Position=2918; Antisense; ATCCCCACACTGAAATGAAATCCTA

Paste this into a BLAST search page for me
ATCCGCACCATCACAATGCGTGGGCATCACAATGCGTGGGCAGCGGCCTATGGGCAGCGGCCTATCATCCACATGATCCACATGCCACCGCCTAGGATGTGATCCTTCCCAAAATTGTTACAGTTAATGCCATAATGTCCCAAAACCCAGTAATGTCCCAAAACCCAGAACGGCAGAACGGCAACAAAGCAAGCGTAGAACCCCAATCTAGTAGCTAAGGCATTTTTTGCATGTCTGTACATACAAACATTAGCGTTCTTTTTAAGCCATACCATGAAACCATCTAGTTGTGTACCATAAAAGGCGACAAAATCCCCACACTGAAATCCCCACACTGAAATGAAATCCTA

Full Affymetrix probeset data:

Annotations for 1633396_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720