Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633398_at:

>probe:Drosophila_2:1633398_at:500:267; Interrogation_Position=1033; Antisense; CAGGGACGTGCCCTTTTCAGGGATT
>probe:Drosophila_2:1633398_at:548:711; Interrogation_Position=1048; Antisense; TTCAGGGATTTACTGGCCCATCTAT
>probe:Drosophila_2:1633398_at:662:181; Interrogation_Position=1081; Antisense; AAAACAGAATCTCGGCCATGGCTCA
>probe:Drosophila_2:1633398_at:22:649; Interrogation_Position=1116; Antisense; TCAGTCTGAGTTTCTTGGCAGGCGT
>probe:Drosophila_2:1633398_at:460:3; Interrogation_Position=1163; Antisense; ATTGTGACCACTCCTTTCGACGTGG
>probe:Drosophila_2:1633398_at:281:393; Interrogation_Position=1217; Antisense; GAAAGGGTCATCTTCACGGACTCGC
>probe:Drosophila_2:1633398_at:624:335; Interrogation_Position=1264; Antisense; GTCGACCTTCAGCAGACTAACGGGT
>probe:Drosophila_2:1633398_at:593:539; Interrogation_Position=1286; Antisense; GGTATTTACAGGACACACGGCGTGC
>probe:Drosophila_2:1633398_at:668:445; Interrogation_Position=1326; Antisense; GATGCGGACCCAGGCTTCTGAAGGT
>probe:Drosophila_2:1633398_at:187:631; Interrogation_Position=1397; Antisense; TCCTTCTTCTTCCATTACAACGTGA
>probe:Drosophila_2:1633398_at:153:31; Interrogation_Position=1428; Antisense; ATAACGAGGCCCTACTCCTGGACAA
>probe:Drosophila_2:1633398_at:140:85; Interrogation_Position=1495; Antisense; AGATGGGTGGCTCCTTTGTAAATAA
>probe:Drosophila_2:1633398_at:39:103; Interrogation_Position=942; Antisense; AGACCTACGCCCAGATGCTGCAGTT
>probe:Drosophila_2:1633398_at:146:635; Interrogation_Position=966; Antisense; TCGTCCGGAGTGTGGTGGCCCTTCA

Paste this into a BLAST search page for me
CAGGGACGTGCCCTTTTCAGGGATTTTCAGGGATTTACTGGCCCATCTATAAAACAGAATCTCGGCCATGGCTCATCAGTCTGAGTTTCTTGGCAGGCGTATTGTGACCACTCCTTTCGACGTGGGAAAGGGTCATCTTCACGGACTCGCGTCGACCTTCAGCAGACTAACGGGTGGTATTTACAGGACACACGGCGTGCGATGCGGACCCAGGCTTCTGAAGGTTCCTTCTTCTTCCATTACAACGTGAATAACGAGGCCCTACTCCTGGACAAAGATGGGTGGCTCCTTTGTAAATAAAGACCTACGCCCAGATGCTGCAGTTTCGTCCGGAGTGTGGTGGCCCTTCA

Full Affymetrix probeset data:

Annotations for 1633398_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime