FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633399_at:

>probe:Drosophila_2:1633399_at:261:251; Interrogation_Position=712; Antisense; CAAGTGCGTCGTATGGTGGACCGTA
>probe:Drosophila_2:1633399_at:382:619; Interrogation_Position=716; Antisense; TGCGTCGTATGGTGGACCGTATGTC
>probe:Drosophila_2:1633399_at:50:293; Interrogation_Position=718; Antisense; CGTCGTATGGTGGACCGTATGTCGC
>probe:Drosophila_2:1633399_at:37:521; Interrogation_Position=727; Antisense; GTGGACCGTATGTCGCGGAGTCCTT
>probe:Drosophila_2:1633399_at:437:479; Interrogation_Position=734; Antisense; GTATGTCGCGGAGTCCTTTCAACCA
>probe:Drosophila_2:1633399_at:127:61; Interrogation_Position=736; Antisense; ATGTCGCGGAGTCCTTTCAACCAGT
>probe:Drosophila_2:1633399_at:707:329; Interrogation_Position=741; Antisense; GCGGAGTCCTTTCAACCAGTCTTCG
>probe:Drosophila_2:1633399_at:120:51; Interrogation_Position=745; Antisense; AGTCCTTTCAACCAGTCTTCGGCTA
>probe:Drosophila_2:1633399_at:274:271; Interrogation_Position=749; Antisense; CTTTCAACCAGTCTTCGGCTAAGTA
>probe:Drosophila_2:1633399_at:46:1; Interrogation_Position=755; Antisense; ACCAGTCTTCGGCTAAGTAATCCCA
>probe:Drosophila_2:1633399_at:156:85; Interrogation_Position=758; Antisense; AGTCTTCGGCTAAGTAATCCCATTT
>probe:Drosophila_2:1633399_at:353:515; Interrogation_Position=760; Antisense; TCTTCGGCTAAGTAATCCCATTTCC
>probe:Drosophila_2:1633399_at:187:327; Interrogation_Position=766; Antisense; GCTAAGTAATCCCATTTCCCCATTT
>probe:Drosophila_2:1633399_at:15:495; Interrogation_Position=794; Antisense; TTGGTCAAATTAAACGTGAAAGCAT

Paste this into a BLAST search page for me
CAAGTGCGTCGTATGGTGGACCGTATGCGTCGTATGGTGGACCGTATGTCCGTCGTATGGTGGACCGTATGTCGCGTGGACCGTATGTCGCGGAGTCCTTGTATGTCGCGGAGTCCTTTCAACCAATGTCGCGGAGTCCTTTCAACCAGTGCGGAGTCCTTTCAACCAGTCTTCGAGTCCTTTCAACCAGTCTTCGGCTACTTTCAACCAGTCTTCGGCTAAGTAACCAGTCTTCGGCTAAGTAATCCCAAGTCTTCGGCTAAGTAATCCCATTTTCTTCGGCTAAGTAATCCCATTTCCGCTAAGTAATCCCATTTCCCCATTTTTGGTCAAATTAAACGTGAAAGCAT

Full Affymetrix probeset data:

Annotations for 1633399_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720