FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633400_at:

>probe:Drosophila_2:1633400_at:415:283; Interrogation_Position=2206; Antisense; CTGCGCCTCAAAACTGAACCTTGTG
>probe:Drosophila_2:1633400_at:156:381; Interrogation_Position=2221; Antisense; GAACCTTGTGATAGTCGTCGTCGTC
>probe:Drosophila_2:1633400_at:434:243; Interrogation_Position=2350; Antisense; AATTACCAACCAGCCACAGCAATGT
>probe:Drosophila_2:1633400_at:397:655; Interrogation_Position=2394; Antisense; TAATACTTAACACTCGCCTGGGACA
>probe:Drosophila_2:1633400_at:19:287; Interrogation_Position=2411; Antisense; CTGGGACACTTAACACTCGCCAAAC
>probe:Drosophila_2:1633400_at:224:685; Interrogation_Position=2465; Antisense; TTTTACTTAGCGATCTTCGGTCTCG
>probe:Drosophila_2:1633400_at:441:717; Interrogation_Position=2480; Antisense; TTCGGTCTCGTTAATTTATTCGTAG
>probe:Drosophila_2:1633400_at:583:75; Interrogation_Position=2503; Antisense; AGGATCATTTTACGCCACAATTAGG
>probe:Drosophila_2:1633400_at:487:461; Interrogation_Position=2578; Antisense; GATTCGGTTTCACTTTGAATACGTC
>probe:Drosophila_2:1633400_at:376:219; Interrogation_Position=2619; Antisense; AAGTCGCGCGACTGACATTAGCTTT
>probe:Drosophila_2:1633400_at:549:661; Interrogation_Position=2643; Antisense; TAAAAACGGATTACGCGGCCGCAAG
>probe:Drosophila_2:1633400_at:99:607; Interrogation_Position=2681; Antisense; TGATGATTGCATCCGGATCTGTTGT
>probe:Drosophila_2:1633400_at:695:85; Interrogation_Position=2720; Antisense; AGTGCGTCATTGTGCAAGTTCCTGT
>probe:Drosophila_2:1633400_at:187:217; Interrogation_Position=2735; Antisense; AAGTTCCTGTTTCGCCAAGTTGTGA

Paste this into a BLAST search page for me
CTGCGCCTCAAAACTGAACCTTGTGGAACCTTGTGATAGTCGTCGTCGTCAATTACCAACCAGCCACAGCAATGTTAATACTTAACACTCGCCTGGGACACTGGGACACTTAACACTCGCCAAACTTTTACTTAGCGATCTTCGGTCTCGTTCGGTCTCGTTAATTTATTCGTAGAGGATCATTTTACGCCACAATTAGGGATTCGGTTTCACTTTGAATACGTCAAGTCGCGCGACTGACATTAGCTTTTAAAAACGGATTACGCGGCCGCAAGTGATGATTGCATCCGGATCTGTTGTAGTGCGTCATTGTGCAAGTTCCTGTAAGTTCCTGTTTCGCCAAGTTGTGA

Full Affymetrix probeset data:

Annotations for 1633400_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720