FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633402_at:

>probe:Drosophila_2:1633402_at:39:677; Interrogation_Position=1149; Antisense; TAGAGATGTGCTGCTCCAAACTCAG
>probe:Drosophila_2:1633402_at:264:65; Interrogation_Position=1199; Antisense; ATGGGACATTGTGTCTGGCCCAGAT
>probe:Drosophila_2:1633402_at:155:33; Interrogation_Position=1229; Antisense; ATAATCTAATCTCAGCTGGCATCAG
>probe:Drosophila_2:1633402_at:316:61; Interrogation_Position=1322; Antisense; ATGTGAGCCAACCTCTGGCCAGGAT
>probe:Drosophila_2:1633402_at:113:15; Interrogation_Position=1345; Antisense; ATTACTGGACTGGATCCTGCGGGTC
>probe:Drosophila_2:1633402_at:620:329; Interrogation_Position=1363; Antisense; GCGGGTCCTGGCTTTATGATGCAGC
>probe:Drosophila_2:1633402_at:518:445; Interrogation_Position=1380; Antisense; GATGCAGCCCTCCTTGCAGCAAAAA
>probe:Drosophila_2:1633402_at:141:287; Interrogation_Position=1405; Antisense; CTGGATGCCAGTGATGCCGACTTTG
>probe:Drosophila_2:1633402_at:95:51; Interrogation_Position=1418; Antisense; ATGCCGACTTTGTGGACATCATACA
>probe:Drosophila_2:1633402_at:190:447; Interrogation_Position=1464; Antisense; GATGCTGCCGCCAATGGGTCATGCA
>probe:Drosophila_2:1633402_at:602:531; Interrogation_Position=1479; Antisense; GGGTCATGCAGACTTTTACCCCAAT
>probe:Drosophila_2:1633402_at:589:233; Interrogation_Position=1501; Antisense; AATCTCGACCAGCTTAATCAGCGGG
>probe:Drosophila_2:1633402_at:254:699; Interrogation_Position=1617; Antisense; TTTTTGGGCCCAGCAATGCGGTGGA
>probe:Drosophila_2:1633402_at:479:547; Interrogation_Position=1639; Antisense; GGATGGTTCGATTTCTTCTCGCAGC

Paste this into a BLAST search page for me
TAGAGATGTGCTGCTCCAAACTCAGATGGGACATTGTGTCTGGCCCAGATATAATCTAATCTCAGCTGGCATCAGATGTGAGCCAACCTCTGGCCAGGATATTACTGGACTGGATCCTGCGGGTCGCGGGTCCTGGCTTTATGATGCAGCGATGCAGCCCTCCTTGCAGCAAAAACTGGATGCCAGTGATGCCGACTTTGATGCCGACTTTGTGGACATCATACAGATGCTGCCGCCAATGGGTCATGCAGGGTCATGCAGACTTTTACCCCAATAATCTCGACCAGCTTAATCAGCGGGTTTTTGGGCCCAGCAATGCGGTGGAGGATGGTTCGATTTCTTCTCGCAGC

Full Affymetrix probeset data:

Annotations for 1633402_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720