FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633403_at:

>probe:Drosophila_2:1633403_at:18:525; Interrogation_Position=1198; Antisense; GGGCGAATGGAATCCCAGCCTGCAG
>probe:Drosophila_2:1633403_at:430:309; Interrogation_Position=1212; Antisense; CCAGCCTGCAGTTGTTCGTAATGAT
>probe:Drosophila_2:1633403_at:205:603; Interrogation_Position=1260; Antisense; TGTTGTTGATGCATTTCTACGCCCC
>probe:Drosophila_2:1633403_at:464:89; Interrogation_Position=1285; Antisense; AGTAACTAAGCGCACAGTCTCTCTT
>probe:Drosophila_2:1633403_at:667:317; Interrogation_Position=1319; Antisense; GCCGGAATCCCAGTGCACAGAATTT
>probe:Drosophila_2:1633403_at:210:25; Interrogation_Position=1438; Antisense; ATATGGGTCCTGGTCAAGTCTATAC
>probe:Drosophila_2:1633403_at:706:217; Interrogation_Position=1453; Antisense; AAGTCTATACTCTGCACCACAGTGT
>probe:Drosophila_2:1633403_at:596:471; Interrogation_Position=1535; Antisense; GTTCTAAGCCAGATGTATCGTACTA
>probe:Drosophila_2:1633403_at:587:293; Interrogation_Position=1564; Antisense; CGTTGTTTGCATTTTTGTATTCCTA
>probe:Drosophila_2:1633403_at:707:585; Interrogation_Position=1592; Antisense; TGGACACTAACTTTTTGCTAATCTA
>probe:Drosophila_2:1633403_at:707:15; Interrogation_Position=1628; Antisense; ATTTAGGCAGCTTTACGGCAATCGA
>probe:Drosophila_2:1633403_at:478:311; Interrogation_Position=1664; Antisense; GCCAATTACTCTTGTTGCAACGTGT
>probe:Drosophila_2:1633403_at:20:249; Interrogation_Position=1738; Antisense; CAATCAACTCCTTGAGCGATCTTGC
>probe:Drosophila_2:1633403_at:172:453; Interrogation_Position=1755; Antisense; GATCTTGCAGTCAAAGGAGCTCGCA

Paste this into a BLAST search page for me
GGGCGAATGGAATCCCAGCCTGCAGCCAGCCTGCAGTTGTTCGTAATGATTGTTGTTGATGCATTTCTACGCCCCAGTAACTAAGCGCACAGTCTCTCTTGCCGGAATCCCAGTGCACAGAATTTATATGGGTCCTGGTCAAGTCTATACAAGTCTATACTCTGCACCACAGTGTGTTCTAAGCCAGATGTATCGTACTACGTTGTTTGCATTTTTGTATTCCTATGGACACTAACTTTTTGCTAATCTAATTTAGGCAGCTTTACGGCAATCGAGCCAATTACTCTTGTTGCAACGTGTCAATCAACTCCTTGAGCGATCTTGCGATCTTGCAGTCAAAGGAGCTCGCA

Full Affymetrix probeset data:

Annotations for 1633403_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720