Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633404_at:

>probe:Drosophila_2:1633404_at:352:577; Interrogation_Position=1166; Antisense; GGCGCTCCAAGTCGATCCTGAAAAA
>probe:Drosophila_2:1633404_at:266:181; Interrogation_Position=1188; Antisense; AAACAAGTCTGATATCTCGCGCGTC
>probe:Drosophila_2:1633404_at:656:121; Interrogation_Position=1228; Antisense; AGCGAGCGTCTCCTGGCGGACAACA
>probe:Drosophila_2:1633404_at:425:253; Interrogation_Position=1275; Antisense; CAACGGCACCGTTATGGGCGAATCC
>probe:Drosophila_2:1633404_at:548:705; Interrogation_Position=1286; Antisense; TTATGGGCGAATCCGGCAGCGATTA
>probe:Drosophila_2:1633404_at:141:567; Interrogation_Position=1300; Antisense; GGCAGCGATTACTCACCGAATAAAT
>probe:Drosophila_2:1633404_at:52:15; Interrogation_Position=1323; Antisense; ATTACCTCATTCAGTTTTAGCTAAG
>probe:Drosophila_2:1633404_at:270:697; Interrogation_Position=1338; Antisense; TTTAGCTAAGTCTATATCCCCACCA
>probe:Drosophila_2:1633404_at:424:75; Interrogation_Position=1398; Antisense; AGGACCAGCGACCTTGCAATCGAAG
>probe:Drosophila_2:1633404_at:610:235; Interrogation_Position=1415; Antisense; AATCGAAGCCCACGAAGTTCCAGAC
>probe:Drosophila_2:1633404_at:126:615; Interrogation_Position=1475; Antisense; TGAAGCCGCTGCTCTCGCGAGGAAC
>probe:Drosophila_2:1633404_at:108:441; Interrogation_Position=1531; Antisense; GATGGCCAGCAGACCAGGGACAGCA
>probe:Drosophila_2:1633404_at:707:113; Interrogation_Position=1552; Antisense; AGCAGTCTGGACTCGGAGACGACCT
>probe:Drosophila_2:1633404_at:359:199; Interrogation_Position=1690; Antisense; AACGATGAGCAGAGGGCCCTTCTCC

Paste this into a BLAST search page for me
GGCGCTCCAAGTCGATCCTGAAAAAAAACAAGTCTGATATCTCGCGCGTCAGCGAGCGTCTCCTGGCGGACAACACAACGGCACCGTTATGGGCGAATCCTTATGGGCGAATCCGGCAGCGATTAGGCAGCGATTACTCACCGAATAAATATTACCTCATTCAGTTTTAGCTAAGTTTAGCTAAGTCTATATCCCCACCAAGGACCAGCGACCTTGCAATCGAAGAATCGAAGCCCACGAAGTTCCAGACTGAAGCCGCTGCTCTCGCGAGGAACGATGGCCAGCAGACCAGGGACAGCAAGCAGTCTGGACTCGGAGACGACCTAACGATGAGCAGAGGGCCCTTCTCC

Full Affymetrix probeset data:

Annotations for 1633404_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime